Amegilla crenata

Leijs, 2020 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records11

Data sources3

Biological traits0

DNA specimens4

eDNA detections0

Sources3 archives

Databases and archives Amegilla crenata's data was compiled from.

GBIFGlobal Biodiversity Information Facility11 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF11 records

DNA & barcodingBOLD4 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla crenata has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.33%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

88Gmostly conserved

181Gmostly conserved

415Amostly conserved

433Avariable

GATAATTTATTTTATTTTTGCTTTGTGGTCTGGTATGTTGGGAACTTCTATAAGTATGATTATTCGAATAGAGCTTAGAGCTCCGGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora mucidasame family13.5%Anthophora quadrimaculatasame family13.9%Anthophora dufouriisame family13.9%Anthophora femoratasame family14.4%Anthophora nigricepssame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type11 records

Wild obs. + sensor2

Museum / vouchered9

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum and Art Gallery of the Northern Territorylocation not on record	7
Natick, US	2

2 institutions · 9 of 9 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)