Amegilla calens

(Lepeletier, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records425

Data sources6

Biological traits0

DNA specimens54

eDNA detections55

Sources6 archives

Databases and archives Amegilla calens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility425 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF425 records

Environmental DNA1 datasets · 5 countries55 detections

DNA & barcodingBOLD54 specimens

01Narrative

Amegilla calens is een vliesvleugelig insect uit de familie bijen en hommels (Apidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1841 door Lepeletier. De diersoort komt voor in Zimbabwe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla calens has left across the world's sequence archives.

At a glance

DNA specimens54

BINs1

Marker genes1

eDNA detections55

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus51 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

85Tmostly conserved

133Tmostly conserved

268Tmostly conserved

298Cmostly conserved

427Tmostly conserved

559Avariable

598Tvariable

616Tmostly conserved

625Tmostly conserved

AAATTACTTTTTATTTGCTATATGGTCAGGTATAGTAGGGTCTTCTATAAGGATAATTATCCGGATAGAACTTAGGGTTCCAGGTGCCTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.72%

Haplotypes8

BIN1

Most divergent pair0.92%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amegilla thorogoodisame genus13.8%Amegilla pulchrasame genus13.9%Amegilla walkerisame genus14.0%Amegilla paeninsulaesame genus14.2%Amegilla calceiferasame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type425 records

Wild obs. + sensor7

Museum / vouchered418

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 3

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 2≤10 km 13>10 km 13

28 georeferenced · 390 without coordinates

Open the institutions mapphysical evidence418

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ARC-Plant Protection Research Institute, National Collection of Fungi: Culture Collectionlocation not on record	192
Atlantic Reference Centrelocation not on record	108
Cape Town, ZA	36
Sydney, AU	25
Durban Natural Science Museumlocation not on record	18
Cambridge, US	17
Wuzhou, CN	17
Agricultural Research Council, South Africalocation not on record	3
Beltsville, US	1
	1

10 institutions · 418 of 418 vouchered records shown

09Environmental DNA55 detections

Where the DNA of Amegilla calens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map5 countries0

OlifantÂ Rugged Veld2. Savanna | 2.1. Dry SavannaMalelaneÂ Mountain BushveldMopane/Bushwillow WoodlandsMopaneÂ Shrubveld4. Native Grassland | 4.6. Subtropical/Tropi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 20.0–26.4

Seasonal swing summer↔winter8.90 °C

Max temp (day)29.1 °C 25.9–31.1

Min temp (night)17.7 °C 13.9–21.6

Precipitation44.5 mm/mo 6.10–113

Air humidity54.9 % 52.1–60.1

Moisture balance-82.4 mm/mo -126–-35.3

Vapour deficit1,307 Pa 1,032–1,551

Wind speed3.10 m/s 2.30–4.40

Cloud cover32.0 % 9.60–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)