Ambrosiodmus rubricollis

Wood & Bright, 1992 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Ambrosiodmus

At a glance

Occurrence records49

Data sources5

Biological traits0

DNA specimens20

eDNA detections19

Sources5 archives

Databases and archives Ambrosiodmus rubricollis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD20 specimens

01Narrative

Ambrosiodmus rubricollis – gatunek chrząszcza z rodziny ryjkowcowatych i podrodziny kornikowatych. Gatunek ten opisany został w 1875 roku przez W.J. Eichhoffa jako Xyleborus rubricollis. Samica ma ciało długości od 3,6 do 4 mm, ubarwione bardzo ciemnobrązowo. W częściach opadających pokryw międzyrzędy podobnie granulowane, te na drugim międzyrzędzie co najmniej nie są wyraźnie większe niż na pierwszym i trzecim. W części dyskowej pokryw punkty na międzyrzędach delikatnie ziarenkowane, trochę zaburzone do tworzących prawie pojedynczy rządek. Ryjkowiec azjatycki, zawleczony do Australii i Stanów Zjednoczonych. Z tych ostatnich podany po raz pierwszy w 1968 roku. Występuje tam w Alabamie, Connecticut, Delaware, Florydzie, Karolinie Południowej, Luizjanie, Maryland, Missisipi, Pensylwanii, Tennessee i Wirginii.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambrosiodmus rubricollis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs4

Marker genes1

eDNA detections19

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 73% of positions are identical in every specimen.

Diversity (π)6.8%

Haplotypes1

BINs4

Where individuals differ — all 179 variable positions, in barcode order

16Tmostly conserved

19Cmostly conserved

22Tmostly conserved

23Tmostly conserved

24Cmostly conserved

25Amostly conserved

28Gmostly conserved

31Amostly conserved

34Amostly conserved

40Amostly conserved

49Cmostly conserved

50Tmostly conserved

52Gmostly conserved

58Amostly conserved

59Amostly conserved

61Amostly conserved

64Tmostly conserved

74Tmostly conserved

76Amostly conserved

79Amostly conserved

82Amostly conserved

85Amostly conserved

91Gmostly conserved

92Tmostly conserved

95Amostly conserved

97Tmostly conserved

98Gmostly conserved

99Gmostly conserved

103Tmostly conserved

106Tmostly conserved

112Tmostly conserved

115Tmostly conserved

118Tmostly conserved

121Amostly conserved

127Tmostly conserved

136Cmostly conserved

139Cmostly conserved

143Gmostly conserved

145Amostly conserved

148Amostly conserved

151Cmostly conserved

157Tmostly conserved

163Tmostly conserved

169Amostly conserved

172Tmostly conserved

173Cmostly conserved

184Amostly conserved

187Cmostly conserved

197Tmostly conserved

202Amostly conserved

205Amostly conserved

206Cmostly conserved

212Cmostly conserved

214Tmostly conserved

217Tmostly conserved

220Tmostly conserved

223Tmostly conserved

232Amostly conserved

235Tmostly conserved

242Tmostly conserved

247Tmostly conserved

259Cmostly conserved

262Gmostly conserved

263Cmostly conserved

265Tmostly conserved

268Amostly conserved

271Tmostly conserved

277Tmostly conserved

278Tmostly conserved

283Tmostly conserved

286Tmostly conserved

289Tmostly conserved

290Cmostly conserved

292Amostly conserved

307Cmostly conserved

310Cmostly conserved

316Amostly conserved

319Amostly conserved

322Amostly conserved

325Tmostly conserved

328Amostly conserved

334Amostly conserved

337Amostly conserved

340Cmostly conserved

343Tmostly conserved

346Cmostly conserved

347Cmostly conserved

352Tmostly conserved

353Gmostly conserved

355Amostly conserved

358Cmostly conserved

361Tmostly conserved

364Amostly conserved

370Amostly conserved

379Amostly conserved

380Gmostly conserved

385Cmostly conserved

386Tmostly conserved

391Amostly conserved

394Tmostly conserved

400Cmostly conserved

401Tmostly conserved

406Tmostly conserved

416Gmostly conserved

417Cmostly conserved

418Tmostly conserved

421Amostly conserved

424Cmostly conserved

427Cmostly conserved

428Tmostly conserved

430Amostly conserved

433Amostly conserved

436Amostly conserved

439Cmostly conserved

442Cmostly conserved

445Cmostly conserved

448Tmostly conserved

451Amostly conserved

454Amostly conserved

457Tmostly conserved

+59 more variable positions not shown

AACTTTATACTTCATTTTCGGTTCATGGGCAGGAATAGTAGGAACATCCTTGAGAGTAATAATTCGAACAGAATTAGGAACACCAGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambrosiodmus minorsame genus14.6%Euwallacea destruenssame family14.9%Xyleborus cryptographussame family15.1%Xyleborinus bicornatulussame family15.1%Debus pumilussame family15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor13

Museum / vouchered36

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced · 9 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 2≤10 km 2>10 km 3

8 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	13
Mississippi State, US	5
Lexington, US	3
Wuzhou, CN	2
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	2
Colorado State Universitylocation not on record	2
University of Central Floridalocation not on record	2
CUlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
University Park, US	1
UDlocation not on record	1

11 institutions · 33 of 36 vouchered records shown · 3 without an institution code

09Environmental DNA19 detections

Where the DNA of Ambrosiodmus rubricollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 13.6–23.1

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 17.0–25.6

Min temp (night)19.9 °C 10.5–21.4

Precipitation94.8 mm/mo 94.8–101

Air humidity58.0 % 58.0–60.5

Moisture balance-97.2 mm/mo -105–1.60

Vapour deficit1,086 Pa 679–1,192

Wind speed6.10 m/s 4.00–6.10

Cloud cover39.2 % 36.9–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)