Amblyptilia pica

(Walsingham, 1880) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Amblyptilia

At a glance

Occurrence records808

Data sources8

Biological traits0

DNA specimens82

eDNA detections77

Sources8 archives

Databases and archives Amblyptilia pica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility808 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics82 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF808 records

Environmental DNA1 datasets · 2 countries77 detections

DNA & barcodingBOLD82 specimens

01Narrative

Amblyptilia pica, the geranium plume moth, is a moth of the family Pterophoridae. The species was first described by Baron Walsingham in 1880. It is found in western North America from Alaska to California, inland to Alberta and Kansas. It is also found in the north-eastern United States and Ontario. The wingspan is 18 -. Adults have dark grey forewings mottled with black. They are on wing in spring and fall and have been recorded feeding on the flower nectar of Salix species. The larvae feed on Scrophulariaceae, Geraniaceae, Primulaceae, Labiatae and Caprifoliaceae species, including Castilleja species, Pedicularis furbishiae and Scrophularia californica, Penstemon whippleanus. They feed externally on the foliage and flower buds of their host plant, but also bore into the seedpods and mine the leaves. The species overwinters as an adult.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding82 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyptilia pica has left across the world's sequence archives.

At a glance

DNA specimens82

BINs2

Marker genes1

eDNA detections77

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 131 variable positions, in barcode order

1Gmostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

8Tmostly conserved

9Amostly conserved

13Cmostly conserved

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

22Amostly conserved

26Tmostly conserved

30Cmostly conserved

31Tmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

36Tmostly conserved

38Gmostly conserved

41Gmostly conserved

43Amostly conserved

44Amostly conserved

45Cmostly conserved

46Tmostly conserved

48Cmostly conserved

49Tmostly conserved

56Tmostly conserved

58Amostly conserved

59Tmostly conserved

60Tmostly conserved

62Amostly conserved

63Tmostly conserved

64Cmostly conserved

69Cmostly conserved

70Amostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

82Tmostly conserved

85Amostly conserved

86Gmostly conserved

88Gvariable

91Amostly conserved

97Tmostly conserved

100Tmostly conserved

106Tmostly conserved

121Amostly conserved

127Tmostly conserved

139Cmostly conserved

154Cmostly conserved

163Amostly conserved

169Tmostly conserved

172Cvariable

181Gvariable

190Tmostly conserved

193Cmostly conserved

197Cmostly conserved

199Tmostly conserved

202Tmostly conserved

205Tmostly conserved

212Tmostly conserved

217Gmostly conserved

232Tmostly conserved

238Cmostly conserved

259Cmostly conserved

265Tmostly conserved

266Tmostly conserved

268Amostly conserved

271Tmostly conserved

278Tmostly conserved

280Amostly conserved

282Cmostly conserved

287Tmostly conserved

298Amostly conserved

302Gmostly conserved

304Tmostly conserved

337Tmostly conserved

343Gmostly conserved

346Tmostly conserved

347Tmostly conserved

349Amostly conserved

352Tmostly conserved

355Tmostly conserved

368Gmostly conserved

370Tmostly conserved

373Amostly conserved

379Tmostly conserved

391Amostly conserved

394Cmostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

407Tmostly conserved

421Tmostly conserved

428Tmostly conserved

433Amostly conserved

448Cmostly conserved

451Amostly conserved

454Amostly conserved

463Tmostly conserved

494Cmostly conserved

496Tmostly conserved

508Tmostly conserved

523Tmostly conserved

536Tmostly conserved

538Amostly conserved

542Cmostly conserved

544Tmostly conserved

553Tmostly conserved

556Amostly conserved

562Tmostly conserved

565Avariable

571Cmostly conserved

578Cmostly conserved

586Tmostly conserved

+11 more variable positions not shown

GACATTATATTTCATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTTTAAGTTTATTAATCCGAGCAGAATTAGGAACTCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes15

BINs2

Most divergent pair14.7%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyptilia punctidactylasame genus5.9%Amblyptilia acanthadactylasame genus9.6%Stenoptilia lutescenssame family10.6%Acopa perpallidasame order11.7%Rhynchopyga meisterisame order12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type808 records

Wild obs. + sensor656

Museum / vouchered152

Range

Area of Occupancy AOO2 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 366≤1 km 69≤10 km 22>10 km 94

551 georeferenced · 105 without coordinates

Open the mapobservation + sensor656

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 13≤1 km 6≤10 km 18>10 km 4

41 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	43
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
East Lansing, US	15
Royal Saskatchewan Museumlocation not on record	7
Denver, US	6
New Haven, US	6
Research Collection of Daniel Handfieldlocation not on record	4
Edmonton, CA	4
Essig Museum of Entomologylocation not on record	4
Canadian Forest Service, Northern Forestry Centrelocation not on record	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	3
Cornell University Insect Collectionlocation not on record	3
Decorah, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
SOVTlocation not on record	1

15 institutions · 119 of 152 vouchered records shown · 33 without an institution code

09Environmental DNA77 detections

Where the DNA of Amblyptilia pica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map2 countries0

Forestsandy beach1. Forest & Woodland | 1.1. Boreal Forestshrubby clearingSubalpine4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 5.20–17.4

Seasonal swing summer↔winter25.1 °C

Max temp (day)18.3 °C 10.8–23.0

Min temp (night)6.20 °C 1.40–12.3

Precipitation79.2 mm/mo 34.1–142

Air humidity55.9 % 51.3–64.0

Moisture balance-32.0 mm/mo -107–49.4

Vapour deficit649 Pa 378–900

Wind speed3.10 m/s 2.00–4.90

Cloud cover39.3 % 31.0–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)