Amblyptilia acanthadactyla

(Hübner, 1813) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Amblyptilia

At a glance

Occurrence records17 530

Data sources7

Biological traits2

DNA specimens64

eDNA detections48

Sources7 archives

Databases and archives Amblyptilia acanthadactyla's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 530 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF17 530 records

Environmental DNA2 datasets · 11 countries48 detections

DNA & barcodingBOLD64 specimens

01Narrative

Amblyptilia acanthadactyla, also known as the beautiful plume, is a moth of the family Pterophoroidea found in across the Palearctic including Europe. The species was first described by the German entomologist, Jacob Hübner in 1813. Amblyptilia acanthadactyla male genitalia

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyptilia acanthadactyla has left across the world's sequence archives.

At a glance

DNA specimens64

BINs1

Marker genes1

eDNA detections48

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

59Cmostly conserved

64Tmostly conserved

100Gmostly conserved

160Gmostly conserved

178Cmostly conserved

181Gmostly conserved

211Amostly conserved

274Gmostly conserved

352Cmostly conserved

370Avariable

508Tmostly conserved

622Amostly conserved

631Gmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTCTACTAATTCGAGCAGAATTAGGAACCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.84%

Haplotypes25

BIN1

Most divergent pair1.8%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyptilia punctidactylasame genus7.0%Amblyptilia picasame genus9.6%Aglaopus ferrugineasame order11.9%Schausiella janeirasame order12.8%Maxates thetydariasame order13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type17 530 records

Wild obs. + sensor16 918

Museum / vouchered559

Other53

Origin

Native15

Range

Area of Occupancy AOO17 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 5 747≤1 km 1 384≤10 km 8 384>10 km 102

15 617 georeferenced · 1 301 without coordinates

Open the mapobservation + sensor16 918

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 220≤1 km 144≤10 km 94

458 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence559

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	221
NHMOlocation not on record	107
SLU Artdatabankenlocation not on record	27
NTNU-VMlocation not on record	21
Provincia di Livornolocation not on record	21
Tartu, EE	19
European Distributed Institute of Taxonomy (EDIT)location not on record	14
Salzburg, AT	8
Nijmegen, NL	7
Garðabær, IS	7
University of Oslo, Natural History Museumlocation not on record	7
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
Natural History Museum Rotterdamlocation not on record	6
neflocation not on record	5
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	4
South Kensington, GB	4
CBDClocation not on record	3
Research Collection of Kai Berggrenlocation not on record	3
Natural History Museum, Londonlocation not on record	3
BioFokuslocation not on record	3
Tiroler Landesmuseum Ferdinandeumlocation not on record	3
ZSMlocation not on record	2
Philadelphia, US	2
Tromsø, NO	2
Research Collection of Richard Heindellocation not on record	1
Stockholm, SE	1
Naturalis Biodiversity Centerlocation not on record	1
Zürich, CH	1
MZLUlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Brussels, BE	1

33 institutions · 514 of 559 vouchered records shown · 45 without an institution code

09Environmental DNA48 detections

Where the DNA of Amblyptilia acanthadactyla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys2

Countries11

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 6.90–17.9

Seasonal swing summer↔winter17.3 °C

Max temp (day)17.1 °C 10.6–22.0

Min temp (night)9.90 °C 2.60–14.9

Precipitation80.1 mm/mo 43.6–164

Air humidity61.1 % 57.1–64.9

Moisture balance-27.1 mm/mo -90.1–115

Vapour deficit654 Pa 374–858

Wind speed2.70 m/s 1.80–5.10

Cloud cover41.7 % 34.8–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amblyptilia acanthadactyla

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type17 530 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 530 records