Amblypodia annetta — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Amblypodia

At a glance

Occurrence records4

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Amblypodia annetta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 records

DNA & barcodingBOLD5 specimens

01Narrative

Amblypodia annetta is a species of butterfly belonging to the lycaenid family described by Otto Staudinger in 1888. It is found in the Australasian realm.Seitz, A., 1912-1927. Die Indo-Australien Tagfalter. Theclinae, Poritiinae, Hesperiidae. Grossschmetterlinge Erde 9: 799-1107, pls. 138-175

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblypodia annetta has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCCTTAGAATTTTAATTCGTATAGAATTAGGAATACCAGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblypodia anitasame genus6.0%Philotes sonorensissame family8.1%Calycopis calussame family9.0%Anthene paraffinissame family9.1%Tomares ballussame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor3

Museum / vouchered1

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	1

1 institutions · 1 of 1 vouchered records shown