Amblypodia anita

Hewitson, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Amblypodia

At a glance

Occurrence records826

Data sources7

Biological traits0

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Amblypodia anita's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility826 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF826 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amblypodia anita, the purple leaf blue or leaf blue, is a lycaenid or blue butterfly found in South Asia and Southeast Asia, including Sri Lanka, India, Myanmar, Malaysia, and Java. The species was first described by William Chapman Hewitson in 1862.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblypodia anita has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.72%

Haplotypes2

BIN1

Most divergent pair0.77%

Where individuals differ — all 11 variable positions, in barcode order

76Gvariable

187Gvariable

232Cmostly conserved

281Tmostly conserved

316Amostly conserved

361Cmostly conserved

430Avariable

553Tmostly conserved

554Tmostly conserved

616Cvariable

625Gmostly conserved

TTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACTTCTCTTAGAATTTTAATTCGAATAGAATTAGGGATACCTGGATCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblypodia annettasame genus6.0%Callophrys poliossame family8.1%Cyanophrys longuloidessame family8.3%Ocaria aholibasame family8.3%Callophrys dumetorumsame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type826 records

Wild obs. + sensor812

Museum / vouchered14

Range

Area of Occupancy AOO1 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 101≤1 km 278≤10 km 121>10 km 72

572 georeferenced · 240 without coordinates

Open the mapobservation + sensor812

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 3>10 km 2

6 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cleveland Museum of Natural History, OH (CLEV)location not on record	7
Cambridge, US	3
Helsinki, FI	2
Auckland, NZ	1
Natural History Museum Rotterdamlocation not on record	1

5 institutions · 14 of 14 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Amblypodia anita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

1. Forest & Woodland | 1.5. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 23.8–23.8

Seasonal swing summer↔winter4.20 °C

Max temp (day)28.0 °C

Min temp (night)19.6 °C

Precipitation263 mm/mo

Air humidity64.7 %

Moisture balance100 mm/mo

Vapour deficit1,035 Pa

Wind speed1.60 m/s

Cloud cover21.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)