Amblygobius semicinctus

(Bennett, 1833) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Amblygobius

At a glance

Occurrence records228

Data sources9

Biological traits7

DNA specimens11

eDNA detections0

Sources9 archives

Databases and archives Amblygobius semicinctus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

OBISOcean Biodiversity Information System95 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS228 records

DNA & barcodingBOLD11 specimens

01Narrative

Amblygobius semicinctus, the halfbarred goby , is a species of goby from family Gobiidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length11 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max20 m

Depth min1 m

Vulnerability10

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblygobius semicinctus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

234Amostly conserved

412Cmostly conserved

465Tmostly conserved

617Cmostly conserved

AAAGACATTGGCACCCTCTACCTTGTATTCGGTGCCTGAGCCGGAATGGTAGGCACGGCACTAAGCCTGCTGATCCGGGCCGAACTTAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.31%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblygobius albimaculatussame genus9.3%Amblygobius stethophthalmussame genus13.9%Amblygobius sphynxsame genus14.4%Amblygobius buanensissame genus14.6%Bathygobius geminatussame family16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type228 records

Wild obs. + sensor92

Museum / vouchered135

Other1

Range

Area of Occupancy AOO388 km²

Depth

0–200 m sunlit28

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 150 m · 28 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 23≤1 km 22≤10 km 9>10 km 13

67 georeferenced · 25 without coordinates

Open the mapobservation + sensor92

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 3>10 km 2

5 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	19
Toronto, CA	15
South African Institute for Aquatic Biodiversitylocation not on record	15
Chicago, US	6
Paris, FR	3
Stockholm, SE	1
Ann Arbor, US	1
Western Australian Museumlocation not on record	1

8 institutions · 61 of 135 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)