Amblyeleotris fontanesii

(Bleeker, 1853) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Amblyeleotris

At a glance

Occurrence records137

Data sources7

Biological traits8

DNA specimens8

eDNA detections0

Sources7 archives

Databases and archives Amblyeleotris fontanesii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

OBISOcean Biodiversity Information System34 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS137 records

DNA & barcodingBOLD8 specimens

01Narrative

Amblyeleotris fontanesii is een straalvinnige vissensoort uit de familie van grondels (Gobiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Pieter Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length25 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max30 m

Depth min5 m

Vulnerability20.5

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyeleotris fontanesii has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

55Amostly conserved

172Gmostly conserved

202Gmostly conserved

247Cmostly conserved

250Amostly conserved

529Amostly conserved

563Gmostly conserved

CCTCTATCTCGTGTTCGGTGCCTGAGCCGGAATAGTGGGCACAGCACTTAGCCTATTGATCCGAGCCGAACTCTCCCAACCCGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes5

BIN1

Most divergent pair0.92%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyeleotris periophthalmasame genus9.5%Amblyeleotris gymnocephalasame genus11.0%Amblyeleotris marquesassame genus11.0%Amblyeleotris downingisame genus11.1%Amblyeleotris sungamisame genus11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type137 records

Wild obs. + sensor85

Museum / vouchered51

Other1

Range

Area of Occupancy AOO316 km²

Depth

0–200 m sunlit12

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 19 m · max 30 m · 12 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 35≤1 km 18≤10 km 5>10 km 5

63 georeferenced · 22 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 5≤1 km 11≤10 km 5>10 km 4

25 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	5
Australian National Fish Collectionlocation not on record	4
Western Australian Museumlocation not on record	3
Sydney, AU	3
Museum and Art Gallery of the Northern Territorylocation not on record	2
Natick, US	2
CASlocation not on record	1
Toronto, CA	1
Honolulu, US	1

9 institutions · 22 of 51 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)