Amblyeleotris downingi

Randall, 1994 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Gobiidae/Amblyeleotris

At a glance

Occurrence records25

Data sources8

Biological traits6

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Amblyeleotris downingi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

OBISOcean Biodiversity Information System11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS25 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Amblyeleotris downingi is een straalvinnige vissensoort uit de familie van grondels (Gobiidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1994 door Randall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max20 m

Depth min13 m

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amblyeleotris downingi has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P668 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.47%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 5 variable positions, in barcode order

180Avariable

315Avariable

495Avariable

659Cvariable

664Gvariable

GTCGGTGCCTGAGCCGGAATAGTGGGCACAGCACTTAGCCTGCTAATCCGAGCCGAACTCTCCCAACCCGGCGCCCTACTGGGGGACGAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amblyeleotris gymnocephalasame genus6.6%Amblyeleotris steinitzisame genus10.6%Amblyeleotris sungamisame genus10.8%Amblyeleotris marquesassame genus10.9%Amblyeleotris fontanesiisame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor13

Museum / vouchered12

Range

Area of Occupancy AOO40 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 22 m · max 25 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 7≤10 km 1

8 georeferenced · 5 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	3
Toronto, CA	2

2 institutions · 5 of 12 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Amblyeleotris downingi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 25.9–25.9

Seasonal swing summer↔winter6.30 °C

Max temp (day)27.4 °C 27.3–27.4

Min temp (night)24.3 °C 24.1–24.4

Precipitation206 mm/mo 53.5–358

Air humidity64.9 % 64.5–65.3

Vapour deficit1,169 Pa 1,155–1,182

Cloud cover28.8 % 23.1–34.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)