Ambassis natalensis

Gilchrist & Thompson, 1908 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Ambassidae/Ambassis

At a glance

Occurrence records331

Data sources8

Biological traits7

DNA specimens16

eDNA detections18

Sources8 archives

Databases and archives Ambassis natalensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

OBISOcean Biodiversity Information System136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS331 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD16 specimens

01Narrative

Ambassis natalensis is een straalvinnige vissensoort uit de familie van Aziatische glasbaarzen (Ambassidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1908 door Gilchrist & Thompson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambassis natalensis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

40Tmostly conserved

97Amostly conserved

100Cmostly conserved

187Amostly conserved

340Amostly conserved

364Cmostly conserved

424Cmostly conserved

478Tmostly conserved

499Avariable

532Tmostly conserved

535Amostly conserved

646Amostly conserved

649Cmostly conserved

CCTTTATCTAATCTTCGGTGCTTGAGCCGGCATAGTAGGTACTGCCCTAAGCCTACTCATTCGAGCAGAACTCGGACAACCTGGTTCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes9

BIN1

Most divergent pair0.77%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambassis macracanthussame genus15.4%Ambassis gymnocephalussame genus15.6%Naso tonganussame order15.8%Naso brachycentronsame order16.0%Naso tuberosussame order16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type331 records

Wild obs. + sensor77

Museum / vouchered238

Other16

Origin

Native74

Range

Area of Occupancy AOO512 km²

Depth

0–200 m sunlit10

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 1.5 m · 10 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 1≤10 km 4>10 km 8

13 georeferenced · 64 without coordinates

Open the mapobservation + sensor77

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 3≤10 km 20>10 km 2

25 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	71
Paris, FR	17
FishBaselocation not on record	6
CASlocation not on record	3
Toronto, CA	3
Ann Arbor, US	2
Stockholm, SE	1
Royal Museum for Central Africalocation not on record	1
South Kensington, GB	1
Chicago, US	1

10 institutions · 106 of 238 vouchered records shown · 16 without an institution code

09Environmental DNA18 detections

Where the DNA of Ambassis natalensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 19.9–26.6

Seasonal swing summer↔winter6.60 °C

Max temp (day)24.4 °C 23.0–28.8

Min temp (night)18.8 °C 15.9–23.7

Precipitation93.8 mm/mo 42.0–115

Air humidity60.2 % 59.1–62.3

Moisture balance-42.3 mm/mo

Vapour deficit1,024 Pa 937–1,315

Wind speed4.40 m/s

Cloud cover23.7 % 17.3–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)