Ambassis macracanthus

Bleeker, 1849 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Ambassidae/Ambassis

At a glance

Occurrence records65

Data sources7

Biological traits6

DNA specimens38

eDNA detections38

Sources7 archives

Databases and archives Ambassis macracanthus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

OBISOcean Biodiversity Information System18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS65 records

Environmental DNA1 datasets · 1 countries38 detections

DNA & barcodingBOLD38 specimens

01Narrative

Ambassis macracanthus is een straalvinnige vissensoort uit de familie van Aziatische glasbaarzen (Ambassidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1849 door Bleeker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10.5 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambassis macracanthus has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

196Avariable

291Amostly conserved

318Gvariable

543Cvariable

612Cmostly conserved

CTTTACCTAATCTTTGGTGCCTGAGCCGGCATAGTGGGCACTGCCTTAAGCCTTCTTATCCGAGCAGAACTAAGCCAACCCGGCTCTCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes10

BINs2

Most divergent pair0.76%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambassis ambassissame genus6.1%Ambassis gymnocephalussame genus12.1%Ambassis marianussame genus13.1%Ambassis dussumierisame genus14.2%Ambassis vachelliisame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor32

Museum / vouchered22

Other11

Range

Area of Occupancy AOO108 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 5 m · 3 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 18≤1 km 1

19 georeferenced · 13 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 6≤1 km 1≤10 km 3>10 km 2

12 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Cambridge, US	1
SEAOBISlocation not on record	1
FishBaselocation not on record	1

5 institutions · 8 of 22 vouchered records shown · 1 without an institution code

09Environmental DNA38 detections

Where the DNA of Ambassis macracanthus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map1 country0

Estuary

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 26.0–28.0

Seasonal swing summer↔winter2.60 °C

Max temp (day)27.4 °C 27.4–29.7

Min temp (night)24.6 °C 24.5–25.8

Precipitation585 mm/mo 134–585

Air humidity67.2 % 63.0–67.2

Moisture balance436 mm/mo

Vapour deficit1,098 Pa 1,098–1,351

Wind speed2.70 m/s

Cloud cover42.1 % 28.3–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)