Amazona finschi

(P.L.Sclater, 1864) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Psittaciformes/Psittacidae/Amazona

At a glance

Occurrence records14 892

Data sources11

Biological traits24

DNA specimens18

eDNA detections16

Sources11 archives

Databases and archives Amazona finschi's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 892 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF14 892 records

Environmental DNA1 datasets · 0 countries16 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT · NCBI1.5 Gbp

01Narrative

The lilac-crowned amazon (Amazona finschi) is a parrot endemic to the Pacific slopes of Mexico. Also known as Finsch's amazon, it is characterized by green plumage, a maroon forehead, and violet-blue crown and neck. The binomial of this bird commemorates the German naturalist and explorer Otto Finsch. In 2006, BirdLife International classified this species as vulnerable. In 2014, IUCN uplisted this species to Endangered.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAnAgeAmnioteDBAVONET

Size & morphology11

Beak depth31.9 mm

Beak length (culmen)35.4 mm

Beak length (nares)28.7 mm

Beak width18 mm

Body mass302 g

Hand-wing index36.5

Kipp's distance69.8 mm

Secondary length122 mm

Tail length109 mm

Tarsus length21.2 mm

Wing length192 mm

Life cycle & reproduction3

Growth rate0.186 /day

Litter size2

Max. longevity310 months

Diet & foraging6

Fruit50 %

Midhigh50 %

Seed50 %

Trophic levelherbivore

Trophic nicheOmnivore

Understory50 %

Habitat & environment4

HabitatWoodland

Migration1.0

Primary lifestyleInsessorial

Range size111 128 km²

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amazona finschi has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes2

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BINs0

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

229Tmostly conserved

AGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATCCTCATCCTACCAGGATTCGGAATTATCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amazona oratrixsame genus2.9%Anthus novaeseelandiaesame order12.8%Vireo nanussame order13.3%Lepidothrix irissame order14.2%Pluvianellus socialissame order14.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amazona finschi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 506 120 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amazona finschi1.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type14 892 records

Wild obs. + sensor14 534

Museum / vouchered345

Other13

Origin

Native53

Range

Area of Occupancy AOO7 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy38% within 1 km

≤100 m 522≤1 km 163≤10 km 24>10 km 1 103

1 812 georeferenced · 12 722 without coordinates

Open the mapobservation + sensor14 534

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 143≤1 km 20≤10 km 57>10 km 5

225 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence345

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moore Laboratory of Zoology, Occidental Collegelocation not on record	83
Cambridge, US	48
	26
US	21
Louisiana State University, Museum of Zoologylocation not on record	19
Los Angeles, US	13
Delaware Museum of Nature and Sciencelocation not on record	11
Philadelphia, US	8
Toronto, CA	8
San Diego, US	7
Berkeley, US	7
Chicago, US	7
Wuzhou, CN	6
University of California Los Angeleslocation not on record	6
South Kensington, GB	6
Mexico City, MX	5
Texas Cooperative Wildlife Collectionlocation not on record	5
Ann Arbor, US	4
Vancouver, CA	4
Seattle, US	3
CASlocation not on record	3
Arizona State University Biocollectionslocation not on record	3
Zacatecas, MX	3
Washington, US	2
EL PASO, US	2
Mongolian Museum of Natural Historylocation not on record	1
Washington State University, Charles R. Conner Museumlocation not on record	1
Musée des Confluenceslocation not on record	1
Ciudad de México, MX	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Paris, FR	1
St. Paul, US	1
Chongqing Museumlocation not on record	1
Tuxtla Gutiérrez, MX	1
Edmonton, CA	1

35 institutions · 320 of 345 vouchered records shown · 25 without an institution code

09Environmental DNA16 detections

Where the DNA of Amazona finschi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amazona finschi

At a glance

Sources11 archives

Size & morphology11

Life cycle & reproduction3

Diet & foraging6

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type14 892 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type14 892 records