Amauropsis islandica

(Gmelin, 1791) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Naticidae/Amauropsis

At a glance

Occurrence records624

Data sources9

Biological traits5

DNA specimens6

eDNA detections4

Sources9 archives

Databases and archives Amauropsis islandica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

OBISOcean Biodiversity Information System68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS624 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amauropsis islandica, common name the Iceland moonsnail, is a species of predatory sea snail, a marine gastropod mollusk in the family Naticidae, the moon snails.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length4 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max1 267 m

Depth min0 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauropsis islandica has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.08%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

316Gmostly conserved

TACTTTATATATTTTATTTGGAATATGATCTGGTTTAGTGGGTACTGCTTTGAGTCTTCTTATTCGAGCTGAATTAGGACAACCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polinices mammillasame family12.2%Neverita didymasame family13.0%Benthomangelia trophonoideasame order13.5%Dolomena labiosasame order14.0%Cryptonatica aleuticasame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type624 records

Wild obs. + sensor251

Museum / vouchered327

Fossil6

Other40

Range

Area of Occupancy AOO1 596 km²

Depth

0–200 m sunlit33

200–1000 m twilight6

1–4 km midnight0

>4 km abyssal0

median 17.4 m · max 460 m · 39 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 141≤1 km 24≤10 km 62

227 georeferenced · 24 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 35≤1 km 32≤10 km 32>10 km 18

117 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence327

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	39
Tromsø, NO	32
Gothenburg, SE	22
Bergen, NO	19
SLU Artdatabankenlocation not on record	17
Los Angeles, US	15
Cambridge, US	14
Stockholm, SE	13
Natural History Museum Rotterdamlocation not on record	13
CASlocation not on record	10
Washington, US	9
New Haven, US	8
Philadelphia, US	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Maurice Lamontagne Institutelocation not on record	7
Bergen, NO	4
Santa Barbara Museum of Natural Historylocation not on record	4
Edmonton, CA	4
NHMOlocation not on record	4
Norwegian Institute of Marine Researchlocation not on record	3
P. P. Shirshov Institute of Oceanologylocation not on record	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Brussels, BE	3
RBINS-Scientific Heritagelocation not on record	3
The Atlantic reference Centrelocation not on record	2
Goteborg Natural History Museumlocation not on record	2
Paleontological Research Institutionlocation not on record	1
Frankfurt am Main	1
Baltic Sea Research Institute Warnemündelocation not on record	1

29 institutions · 271 of 327 vouchered records shown · 12 without an institution code

09Environmental DNA4 detections

Where the DNA of Amauropsis islandica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.20 °C -3.80–7.10

Seasonal swing summer↔winter14.5 °C

Max temp (day)2.40 °C -2.90–8.20

Min temp (night)-1.00 °C -7.20–5.40

Precipitation128 mm/mo 44.4–162

Air humidity63.9 % 62.7–65.0

Moisture balance84.6 mm/mo

Vapour deficit264 Pa 165–393

Wind speed7.00 m/s

Cloud cover61.8 % 53.1–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)