Amauromyza karli

(Hendel, 1927) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Agromyzidae/Amauromyza

At a glance

Occurrence records20

Data sources6

Biological traits0

DNA specimens20

eDNA detections39

Sources6 archives

Databases and archives Amauromyza karli's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF20 records

Environmental DNA4 datasets · 9 countries39 detections

DNA & barcodingBOLD20 specimens

01Narrative

Amauromyza karli is een vliegensoort uit de familie van de mineervliegen (Agromyzidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1927 door Hendel.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauromyza karli has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections39

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

72Amostly conserved

81Cmostly conserved

211Tmostly conserved

495Gmostly conserved

507Amostly conserved

627Amostly conserved

ACTTTATATTTTATATTTGGAGCTTGATCTGGAATAGTAGGAACTTCTCTAAGAATTTTAATTCGAGCTGAACTAGGTCACCCAGGAGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes3

BIN1

Most divergent pair0.31%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azelia cilipessame order10.9%Cyrtoneurina geminatasame order11.0%Limosina silvaticasame order11.0%Drosophila nebulosasame order11.0%Phytomyza pimpinellaesame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type20 records

Wild obs. + sensor11

Museum / vouchered9

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 6>10 km 2

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
McGill University, Lyman Entomological Museumlocation not on record	1
University of Tokyo, Department of Zoologylocation not on record	1

3 institutions · 5 of 9 vouchered records shown · 4 without an institution code

09Environmental DNA39 detections

Where the DNA of Amauromyza karli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys4

Countries9

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map9 countries0

5. Wetlands (inland)UrbanTemperate mixed forest3. Shrubland|3.4. Temperate Shrubland14. Artificial - Terrestrial|14.1 Arable Landfarm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 13.9–21.1

Seasonal swing summer↔winter20.2 °C

Max temp (day)20.7 °C 17.5–26.1

Min temp (night)11.9 °C 10.1–16.7

Precipitation70.0 mm/mo 39.6–124

Air humidity58.9 % 50.4–62.8

Moisture balance-55.4 mm/mo -98.6–0.1

Vapour deficit690 Pa 610–1,127

Wind speed3.20 m/s 2.30–4.40

Cloud cover43.1 % 29.1–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)