Azelia cilipes

(Haliday, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Muscidae/Azelia

At a glance

Occurrence records2 596

Data sources6

Biological traits0

DNA specimens547

eDNA detections701

Sources6 archives

Databases and archives Azelia cilipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 596 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI701 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics547 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 596 records

Environmental DNA5 datasets · 13 countries701 detections

DNA & barcodingBOLD547 specimens

01Narrative

Azelia cilipes is een vliegensoort uit de familie van de echte vliegen (Muscidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1838 door Haliday.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding547 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Azelia cilipes has left across the world's sequence archives.

At a glance

DNA specimens547

BINs2

Marker genes1

eDNA detections701

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus536 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

5Gmostly conserved

191Cmostly conserved

198Gmostly conserved

200Tmostly conserved

230Cmostly conserved

239Gmostly conserved

315Gmostly conserved

344Tmostly conserved

372Gmostly conserved

542Gmostly conserved

545Tmostly conserved

629Gmostly conserved

CTTTGTATTTTATTTTTGGAGCTTGATCCGGAATAGTAGGAACTTCTTTAAGTATTTTAATTCGAGCTGAATTAGGTCATCCTGGAGCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes22

BINs2

Most divergent pair2.1%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Azelia nebulosasame genus3.1%Azelia zetterstedtiisame genus5.0%Azelia triquetrasame genus5.0%Azelia trigonicasame genus6.0%Bengalia torosasame order7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 596 records

Wild obs. + sensor803

Museum / vouchered1 793

Range

Area of Occupancy AOO3 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 474≤1 km 166≤10 km 141>10 km 1

782 georeferenced · 21 without coordinates

Open the mapobservation + sensor803

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 1 605≤1 km 47≤10 km 32>10 km 5

1 689 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence1 793

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	42
University of Guelph, Centre for Biodiversity Genomicslocation not on record	33
NCMGlocation not on record	16
DFFW2018location not on record	9
University of Tokyo, Department of Zoologylocation not on record	8
SLU Artdatabankenlocation not on record	8
CBDClocation not on record	7
University of Guelphlocation not on record	5
Wellcome Sanger Institutelocation not on record	5
Stockholm, SE	3
ZMAAlocation not on record	3
DFlocation not on record	2
NTNU-VMlocation not on record	2
KwaZulu-Natal Museumlocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Tromsø, NO	1
Gothenburg, SE	1
Metsähallituslocation not on record	1
Tilburg, NL	1
neflocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

21 institutions · 151 of 1 793 vouchered records shown · 1 642 without an institution code

09Environmental DNA701 detections

Where the DNA of Azelia cilipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found701

Studies independent surveys5

Countries13

Verifiable raw sequence linked210

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 701 detections have coordinates

Open the map13 countries0

WetlandMixed habitatGarden, coast and birch habitatFarmland, coast and birch habitatGarden and heatland, coastal habitat1.1 Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 7.10–16.2

Seasonal swing summer↔winter11.5 °C

Max temp (day)14.4 °C 9.50–20.0

Min temp (night)8.20 °C 4.20–12.7

Precipitation93.7 mm/mo 59.2–188

Air humidity64.0 % 60.1–69.5

Moisture balance12.4 mm/mo -40.4–132

Vapour deficit496 Pa 327–724

Wind speed4.70 m/s 2.60–6.10

Cloud cover49.6 % 42.1–60.6

CHELSA 1981–2010, ~9 km grid, at location & month of 698 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Azelia cilipes

At a glance

Sources6 archives

At a glance

Record type2 596 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 596 records