Amauris ochlea

(Boisduval, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Amauris

At a glance

Occurrence records448

Data sources7

Biological traits0

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Amauris ochlea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF448 records

DNA & barcodingBOLD4 specimens

01Narrative

Amauris ochlea, the novice, is a butterfly of the family Nymphalidae. It is found in southern and south-east Africa. The wingspan is 55–60 mm for males and 60–65 mm for females. Adults are on wing year round (with peaks in summer and autumn). The larvae feed on Tylophora anomala, Tylophora stolzii, Gymnema, Marsdenia, Secamone, Cynanchum chirindense, Cyanchum abyssinicum, Cynanchum medium, Cynanchum nigrum, Cynanchum natalitium and Cynanchum vincetoxicum."Amauris Hübner, 1816" at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauris ochlea has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P566 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amauris echeriasame genus2.7%Amauris infernasame genus2.8%Amauris albimaculatasame genus3.2%Amauris crawshayisame genus4.6%Amauris elliotisame genus7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type448 records

Wild obs. + sensor306

Museum / vouchered142

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 128≤1 km 93≤10 km 14>10 km 7

242 georeferenced · 64 without coordinates

Open the mapobservation + sensor306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 102≤10 km 22>10 km 12

136 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Muséum d'histoire naturelle de Marseillelocation not on record	100
New Haven, US	19
Cambridge, US	15
MZLUlocation not on record	2
Zürich, CH	1
NTNU University Museum, Department of Natural Historylocation not on record	1

6 institutions · 138 of 142 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)