Amauris crawshayi

Butler, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Amauris

At a glance

Occurrence records37

Data sources7

Biological traits0

DNA specimens6

eDNA detections1

Sources7 archives

Databases and archives Amauris crawshayi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amauris crawshayi is a butterfly in the family Nymphalidae. It is found in Cameroon, Angola, the Democratic Republic of the Congo, Uganda, Rwanda, Burundi, Kenya, Tanzania, Malawi and Zambia. The habitat consists of forests. The larvae feed on Tylophora (including T. anomala), Marsdenia, Cynanchum, Gymnema and Secamone species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauris crawshayi has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

1Cmostly conserved

13Cmostly conserved

88Amostly conserved

268Avariable

304Cmostly conserved

475Tmostly conserved

484Cmostly conserved

562Gmostly conserved

CACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTCTTAGACTTTTAATTCGAACAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.52%

Haplotypes3

BIN1

Most divergent pair1.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amauris infernasame genus4.3%Amauris albimaculatasame genus4.4%Amauris ochleasame genus4.6%Amauris echeriasame genus4.7%Amauris elliotisame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor20

Museum / vouchered17

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 13 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 1≤10 km 11>10 km 3

15 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	9
Cambridge, US	4
Zürich, CH	1
Uniwersytet Jagiellońskilocation not on record	1
Tartu, EE	1
NTNU University Museum, Department of Natural Historylocation not on record	1

6 institutions · 17 of 17 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Amauris crawshayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.6–24.6

Seasonal swing summer↔winter5.50 °C

Max temp (day)26.1 °C

Min temp (night)23.1 °C

Precipitation303 mm/mo

Air humidity63.5 %

Moisture balance121 mm/mo

Vapour deficit1,121 Pa

Wind speed4.00 m/s

Cloud cover31.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)