Amauris niavius

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Amauris

At a glance

Occurrence records471

Data sources10

Biological traits0

DNA specimens11

eDNA detections10

Sources10 archives

Databases and archives Amauris niavius's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility471 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS71 compounds

Occurrence & distributionGBIF471 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amauris niavius - museum specimen Amauris niavius, the friar, is a butterfly of the family Nymphalidae. It is found in the forests of tropical Africa. The wingspan is 80–85 mm for males and 78–82 mm for females. Adults are on wing year-round (with peaks in late summer and autumn). The larvae feed on Cynanchum (including C. medium, C. nigrum and C. vincetoxicum), Gymnema (including G. sylvestre), Marsdenia, Secamone, Tylophora and Ipomoea. Larvae of subspecies dominicanus feed on Gymnema sylvestre."Amauris Hübner, 1816" at Markku Savela's Lepidoptera and Some Other Life Forms

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition71 compounds

Compounds documented for Amauris niavius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lanostane, Tirucallane and Euphane triterpenoids8

Abietane diterpenoids5

Pimarane and Isopimarane diterpenoids5

Serratane triterpenoids5

Stigmastane steroids3

Documented compounds71 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-3-Carene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Phellandrene	present	NPASS
(-)-beta-Phellandrene	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Borneol	present	NPASS
(1R,4aS,4bR,7R,9R,10aR)-7-ethenyl-1-(hydroxymethyl)-1,4a,7-trimethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthren-9-ol	present	NPASS
(1R,4aS,4bR,8aS,10aS)-8a-ethenyl-1,4a,7-trimethyl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthrene-1-carboxylic acid	present	NPASS
(1R,4aS,4bS,10aR)-1,4a-dimethyl-7-propan-2-yl-2,3,4,4b,5,6,10,10a-octahydrophenanthrene-1-carboxylic acid	present	NPASS
(1S,6R,11R,12S,15S,16R,19S,21R)-19-methoxy-1,7,7,11,16,20,20-heptamethylpentacyclo[13.8.0.03,12.06,11.016,21]tricos-3-en-8-one	present	NPASS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amauris niavius has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections10

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 10 variable positions, in barcode order

307Tmostly conserved

343Cmostly conserved

346Cmostly conserved

367Cvariable

373Tmostly conserved

401Tvariable

490Cmostly conserved

554Gmostly conserved

577Amostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCCCTTAGACTTTTAATTCGAACAGAATTAGGAACCCCCGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amauris infernasame genus8.1%Amauris albimaculatasame genus8.5%Amauris crawshayisame genus8.8%Amauris echeriasame genus8.8%Phallaria ophiusariasame order10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type471 records

Wild obs. + sensor278

Museum / vouchered179

Other14

Range

Area of Occupancy AOO1 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 113≤1 km 66≤10 km 21>10 km 8

208 georeferenced · 70 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤100 m 1≤1 km 2≤10 km 109>10 km 35

147 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	87
Cambridge, US	44
Uniwersytet Jagiellońskilocation not on record	17
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Auckland, NZ	5
MZLUlocation not on record	5
Zürich, CH	4
NTNU University Museum, Department of Natural Historylocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Banyoles, ES	1
Durban Natural Science Museumlocation not on record	1
Tartu, EE	1
Denver, US	1
Muséum d'histoire naturelle de Marseillelocation not on record	1

14 institutions · 179 of 179 vouchered records shown

09Environmental DNA10 detections

Where the DNA of Amauris niavius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 14.0–25.1

Seasonal swing summer↔winter7.10 °C

Max temp (day)25.7 °C 19.2–29.9

Min temp (night)17.8 °C 8.70–21.7

Precipitation173 mm/mo 44.6–223

Air humidity63.3 % 58.3–65.8

Moisture balance50.1 mm/mo -77.0–81.3

Vapour deficit908 Pa 686–1,104

Wind speed2.80 m/s 0.8–4.00

Cloud cover39.5 % 20.7–58.0

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)