Amara rubrica

Haldeman, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records292

Data sources7

Biological traits0

DNA specimens48

eDNA detections38

Sources7 archives

Databases and archives Amara rubrica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility292 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF292 records

Environmental DNA1 datasets · 2 countries38 detections

DNA & barcodingBOLD48 specimens

01Narrative

Amara rubrica is a species of seed-eating ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara rubrica has left across the world's sequence archives.

At a glance

DNA specimens48

BINs3

Marker genes1

eDNA detections38

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

49Amostly conserved

74Tmostly conserved

82Tmostly conserved

106Cmostly conserved

166Amostly conserved

181Avariable

193Tmostly conserved

200Amostly conserved

208Gmostly conserved

214Gmostly conserved

220Cmostly conserved

232Cmostly conserved

247Cmostly conserved

250Tmostly conserved

262Gmostly conserved

271Cvariable

275Gmostly conserved

289Tmostly conserved

307Cmostly conserved

310Amostly conserved

316Avariable

322Cmostly conserved

347Tmostly conserved

355Tvariable

364Tmostly conserved

370Tmostly conserved

382Tmostly conserved

388Amostly conserved

427Tmostly conserved

475Tmostly conserved

490Tmostly conserved

493Amostly conserved

508Amostly conserved

514Amostly conserved

517Amostly conserved

532Amostly conserved

565Gvariable

571Tmostly conserved

622Amostly conserved

628Gmostly conserved

634Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGTGCATGATCAGGAATAGTAGGAACTTCATTAAGAATATTAATTCGAGCTGAATTAGGTAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes14

BINs3

Most divergent pair6.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara sinuosasame genus3.8%Amara rectangulasame genus3.8%Amara pseudobrunneasame genus4.6%Amara musculissame genus4.7%Amara brunneasame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type292 records

Wild obs. + sensor32

Museum / vouchered260

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 21≤1 km 7≤10 km 1>10 km 2

31 georeferenced · 1 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 57≤1 km 4≤10 km 34>10 km 10

105 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	82
Decorah, US	52
University of Alberta Museums (UAM)location not on record	23
Cambridge, US	16
Colorado State Universitylocation not on record	9
University Park, US	9
Espace pour la vielocation not on record	8
Royal Saskatchewan Museumlocation not on record	8
OSUClocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Albuquerque, US	4
University of Guelphlocation not on record	4
WIlocation not on record	3
Lubbock, US	2
CUlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
East Lansing, US	1
Champaign, US	1

19 institutions · 236 of 260 vouchered records shown · 24 without an institution code

09Environmental DNA38 detections

Where the DNA of Amara rubrica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map2 countries0

grasslandHerbaceousfarmRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 12.9–18.4

Seasonal swing summer↔winter27.9 °C

Max temp (day)20.7 °C 19.7–24.2

Min temp (night)13.1 °C 8.00–13.7

Precipitation88.7 mm/mo 79.0–137

Air humidity57.2 % 55.2–59.8

Moisture balance-32.7 mm/mo -33.0–-19.4

Vapour deficit757 Pa 675–905

Wind speed5.30 m/s 2.90–6.00

Cloud cover40.5 % 38.1–44.1

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)