Amara impuncticollis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records662

Data sources7

Biological traits0

DNA specimens104

eDNA detections86

Sources7 archives

Databases and archives Amara impuncticollis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics104 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF662 records

Environmental DNA1 datasets · 1 countries86 detections

DNA & barcodingBOLD104 specimens

01Narrative

Amara impuncticollis is a species of seed-eating ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding104 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara impuncticollis has left across the world's sequence archives.

At a glance

DNA specimens104

BINs4

Marker genes1

eDNA detections86

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus91 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

19Tmostly conserved

58Avariable

70Cmostly conserved

109Avariable

145Amostly conserved

181Gmostly conserved

196Gmostly conserved

199Gmostly conserved

263Cmostly conserved

295Amostly conserved

322Amostly conserved

340Cmostly conserved

352Gmostly conserved

382Tmostly conserved

394Cmostly conserved

400Tmostly conserved

412Tmostly conserved

415Tmostly conserved

469Gmostly conserved

485Tmostly conserved

517Tmostly conserved

536Tmostly conserved

547Cmostly conserved

550Gmostly conserved

571Cmostly conserved

622Gmostly conserved

628Tmostly conserved

631Amostly conserved

634Cmostly conserved

637Avariable

641Cmostly conserved

643Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGTACTTCATTAAGTATATTAATTCGAGCCGAATTAGGAAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes15

BINs4

Most divergent pair10.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara otiosasame genus4.1%Amara littoralissame genus4.6%Amara ovatasame genus4.7%Amara turbatasame genus4.7%Amara nitidasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type662 records

Museum / vouchered662

Range

Area of Occupancy AOO564 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 223≤1 km 7≤10 km 70>10 km 56

356 georeferenced · 306 without coordinates

Open the institutions mapphysical evidence662

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tempe, US	274
WIlocation not on record	81
University Park, US	48
OSUClocation not on record	40
College Station, US	39
Essig Museum of Entomologylocation not on record	34
Decorah, US	28
Provo, US	21
Lexington, US	20
University of Alberta Museums (UAM)location not on record	14
NEON Biorepository at Arizona State Universitylocation not on record	10
University of Alabamalocation not on record	9
Universidad Católica de Manizaleslocation not on record	8
UDlocation not on record	8
Espace pour la vielocation not on record	7
Colorado State Universitylocation not on record	5
Lubbock, US	2
Chicago, US	2
Mississippi State, US	1
Canadian Centre for DNA Barcodinglocation not on record	1
Cambridge, US	1
ASUlocation not on record	1
CUlocation not on record	1
EWIClocation not on record	1
Champaign, US	1
Royal Saskatchewan Museumlocation not on record	1

26 institutions · 658 of 662 vouchered records shown · 4 without an institution code

09Environmental DNA86 detections

Where the DNA of Amara impuncticollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map1 country0

pastureHaycultivatedCropsCedar stand with firdeciduousForestwoodyWetlandsmixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 12.8–24.8

Seasonal swing summer↔winter21.7 °C

Max temp (day)24.4 °C 18.4–29.8

Min temp (night)14.4 °C 8.70–20.4

Precipitation108 mm/mo 93.0–120

Air humidity57.1 % 55.4–58.8

Moisture balance-25.9 mm/mo -57.4–-0.1

Vapour deficit947 Pa 730–1,284

Wind speed3.00 m/s 2.40–4.50

Cloud cover38.7 % 32.2–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)