Amara littoralis

Mannerheim, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amara

At a glance

Occurrence records1 386

Data sources5

Biological traits0

DNA specimens106

eDNA detections81

Sources5 archives

Databases and archives Amara littoralis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 386 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics106 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 386 records

Environmental DNA1 datasets · 2 countries81 detections

DNA & barcodingBOLD106 specimens

01Narrative

Amara littoralis is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1843 door Carl Gustaf Mannerheim.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding106 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amara littoralis has left across the world's sequence archives.

At a glance

DNA specimens106

BINs8

Marker genes1

eDNA detections81

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus87 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

10Tmostly conserved

13Tmostly conserved

70Tmostly conserved

85Gmostly conserved

145Tmostly conserved

199Amostly conserved

223Tmostly conserved

263Cmostly conserved

271Tmostly conserved

286Tmostly conserved

295Gmostly conserved

322Tmostly conserved

334Amostly conserved

340Tmostly conserved

347Tmostly conserved

367Tmostly conserved

394Cmostly conserved

400Amostly conserved

409Gmostly conserved

415Amostly conserved

451Tmostly conserved

475Tvariable

485Cmostly conserved

499Amostly conserved

517Tmostly conserved

536Cmostly conserved

547Cmostly conserved

548Tmostly conserved

559Gmostly conserved

581Tmostly conserved

622Amostly conserved

628Amostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGTACTTCATTAAGTATATTAATTCGAGCTGAATTAGGAAATCCGGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes12

BINs8

Most divergent pair9.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amara otiosasame genus1.5%Amara nitidasame genus3.2%Amara ovatasame genus3.5%Amara turbatasame genus3.5%Amara similatasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 386 records

Wild obs. + sensor17

Museum / vouchered1 369

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 9≤1 km 1≤10 km 2>10 km 3

15 georeferenced · 2 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 196≤1 km 8≤10 km 58>10 km 17

279 georeferenced · 1 090 without coordinates

Open the institutions mapphysical evidence1 369

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	692
University of Alberta Museums (UAM)location not on record	285
Tempe, US	193
Helsinki, FI	24
San Diego, US	18
Colorado State Universitylocation not on record	17
University Park, US	16
NEON Biorepository at Arizona State Universitylocation not on record	14
OSUClocation not on record	14
Albuquerque, US	12
Provo, US	11
Edmonton, CA	11
Essig Museum of Entomologylocation not on record	11
University of Alabamalocation not on record	6
Espace pour la vielocation not on record	5
Washington, US	4
University of Guelphlocation not on record	3
EWIClocation not on record	3
Universidad Católica de Manizaleslocation not on record	2
Saint John, CA	2
McGill University, Lyman Entomological Museumlocation not on record	1
CUlocation not on record	1
Decorah, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
San Francisco State Universitylocation not on record	1

25 institutions · 1 348 of 1 369 vouchered records shown · 21 without an institution code

09Environmental DNA81 detections

Where the DNA of Amara littoralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map2 countries0

grasslandHerbaceousclear cut1. Forest & Woodland | 1.4. Temperate ForestfarmElymus belt gravel beachCarolinian forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 10.8–20.4

Seasonal swing summer↔winter26.0 °C

Max temp (day)22.5 °C 17.0–26.2

Min temp (night)10.0 °C 5.00–13.5

Precipitation81.3 mm/mo 39.3–113

Air humidity55.1 % 45.0–58.9

Moisture balance-63.5 mm/mo -122–3.40

Vapour deficit811 Pa 588–1,161

Wind speed3.90 m/s 2.10–5.40

Cloud cover39.3 % 29.5–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amara littoralis

At a glance

Sources5 archives

At a glance

Record type1 386 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 386 records