Alydus pilosulus

Herrich-Schäffer, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Alydidae/Alydus

At a glance

Occurrence records1 544

Data sources8

Biological traits0

DNA specimens15

eDNA detections14

Sources8 archives

Databases and archives Alydus pilosulus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 544 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 544 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT2n = 14

01Narrative

Alydus pilosulus is a species of broad-headed bug in the family Alydidae. It is found in North America and Oceania.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alydus pilosulus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes2

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

46Gvariable

118Tmostly conserved

250Tmostly conserved

286Tmostly conserved

391Tmostly conserved

454Tmostly conserved

517Gmostly conserved

520Avariable

533Cmostly conserved

622Amostly conserved

TACTTTATATTTTTTATTTGGTATATGAGCTGGTATAGTAGGATCGTCATTAAGATGAATTATTCGAATTGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes6

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alydus eurinussame genus2.6%Alydus conspersussame genus2.7%Alydus calcaratussame genus4.0%Burtinus notatipennissame family7.4%Tollius curtulussame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Alydus pilosulus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 131×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 141×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type1 544 records

Wild obs. + sensor1 230

Museum / vouchered314

Range

Area of Occupancy AOO4 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 718≤1 km 154≤10 km 38>10 km 110

1 020 georeferenced · 210 without coordinates

Open the mapobservation + sensor1 230

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤100 m 2≤1 km 21≤10 km 150

173 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence314

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	192
Mississippi State, US	59
University of Central Floridalocation not on record	32
College Station, US	12
Montgomery, US	10
Vancouver, CA	3
CUlocation not on record	1
Cambridge, US	1
New Haven, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Universidad Católica de Manizaleslocation not on record	1

11 institutions · 313 of 314 vouchered records shown · 1 without an institution code

09Environmental DNA14 detections

Where the DNA of Alydus pilosulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 20.9–25.5

Seasonal swing summer↔winter22.5 °C

Max temp (day)27.2 °C 26.6–31.0

Min temp (night)18.3 °C 15.7–20.2

Precipitation118 mm/mo 77.8–137

Air humidity57.9 % 56.5–58.3

Moisture balance-56.6 mm/mo -95.5–-53.5

Vapour deficit1,122 Pa 1,068–1,395

Wind speed4.80 m/s 2.40–6.20

Cloud cover37.2 % 29.6–38.0

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alydus pilosulus

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 544 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 544 records