Alydus eurinus

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Alydidae/Alydus

At a glance

Occurrence records1 241

Data sources7

Biological traits0

DNA specimens25

eDNA detections0

Sources7 archives

Databases and archives Alydus eurinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

GBIFGlobal Biodiversity Information Facility1 241 records↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF1 241 records

DNA & barcodingBOLD25 specimens

01Narrative

Alydus eurinus is a species of broad-headed bug in the family Alydidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alydus eurinus has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

49Amostly conserved

76Avariable

85Amostly conserved

88Amostly conserved

112Cmostly conserved

124Tvariable

127Tvariable

190Cvariable

208Amostly conserved

263Tmostly conserved

268Amostly conserved

331Gvariable

364Avariable

397Cvariable

407Tvariable

427Tmostly conserved

533Cmostly conserved

550Avariable

571Cvariable

622Gmostly conserved

631Amostly conserved

652Tmostly conserved

658Cmostly conserved

TACTTTATATTTCTTATTTGGTATATGAGCTGGTATAGTAGGATCATCATTAAGATGAATTATTCGAATTGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alydus pilosulussame genus2.6%Alydus calcaratussame genus3.8%Burtinus notatipennissame family7.8%Tollius curtulussame family8.5%Megalotomus acutulussame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 241 records

Wild obs. + sensor875

Museum / vouchered366

Origin

Native2

Range

Area of Occupancy AOO3 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 466≤1 km 182≤10 km 27>10 km 57

732 georeferenced · 143 without coordinates

Open the mapobservation + sensor875

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 13≤1 km 41≤10 km 155>10 km 4

213 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence366

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	181
Mississippi State, US	24
Royal Saskatchewan Museumlocation not on record	24
University of Guelphlocation not on record	20
Edmonton, CA	16
Montgomery, US	15
North Carolina State University Insect Museumlocation not on record	13
Natural History Museum of Utahlocation not on record	12
Albuquerque, US	11
College Station, US	10
Universidad Católica de Manizaleslocation not on record	4
Cambridge, US	3
Philadelphia, US	2
Wuzhou, CN	2
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	2
CUlocation not on record	1
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Washington, US	1
Colorado State Universitylocation not on record	1
SOVTlocation not on record	1

22 institutions · 346 of 366 vouchered records shown · 20 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alydus eurinus

At a glance

Sources7 archives

At a glance

Record type1 241 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 22 geolocated

Record type1 241 records