Alvania punctura

(Montagu, 1803) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Rissoidae/Alvania

At a glance

Occurrence records2 169

Data sources8

Biological traits4

DNA specimens11

eDNA detections19

Sources8 archives

Databases and archives Alvania punctura's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 609 records↗

OBISOcean Biodiversity Information System560 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 169 records

Environmental DNA4 datasets · 3 countries19 detections

DNA & barcodingBOLD11 specimens

01Narrative

Alvania punctura is a species of minute sea snail, a marine gastropod mollusk or micromollusk in the family Rissoidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max200 m

Depth min0 m

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alvania punctura has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections19

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

19Tmostly conserved

35Cmostly conserved

97Gmostly conserved

172Amostly conserved

184Amostly conserved

202Cmostly conserved

290Cmostly conserved

412Cmostly conserved

568Tmostly conserved

578Tmostly conserved

AACGTTGTATATTTTATTTGGTATATGATCGGGTCTAGTTGGAACGGCCTTAAGTTTATTAATTCGGGCTGAGTTAGGTCAGCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes7

BIN1

Most divergent pair0.91%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alvania angioyisame genus13.6%Cingula trifasciatasame family14.6%Alvania cimicoidessame genus15.3%Crisilla postremasame family15.5%Aporrhais serresianasame order15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 169 records

Wild obs. + sensor1 088

Museum / vouchered936

Fossil3

Other142

Range

Area of Occupancy AOO3 464 km²

Depth

0–200 m sunlit174

200–1000 m twilight12

1–4 km midnight0

>4 km abyssal0

median 17.5 m · max 425.5 m · 186 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 930≤1 km 19≤10 km 11>10 km 2

962 georeferenced · 126 without coordinates

Open the mapobservation + sensor1 088

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 99≤1 km 77≤10 km 30>10 km 12

218 georeferenced · 718 without coordinates

Open the institutions mapphysical evidence936

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	128
CEFASlocation not on record	61
Natural History Museum Rotterdamlocation not on record	60
PNHSlocation not on record	41
NTNU-VMlocation not on record	32
Institut Francais pour l'Etude de la Merlocation not on record	32
Bergen, NO	29
Gothenburg, SE	28
730location not on record	14
Norwegian Institute of Marine Researchlocation not on record	11
486location not on record	11
Brussels, BE	10
Paris, FR	10
RBINS-Scientific Heritagelocation not on record	8
Stockholm, SE	8
SLU Artdatabankenlocation not on record	7
Santa Barbara Museum of Natural Historylocation not on record	7
ARMS-MBONlocation not on record	5
Barcelona, ES	5
Bergen, NO	5
Cambridge, US	4
Citadel Hill, GB	3
Philadelphia, US	1
AUTHlocation not on record	1
BioFokuslocation not on record	1
Johanna Bergkvistlocation not on record	1
Biomorlocation not on record	1
New Haven, US	1
DRN, AT, EBSlocation not on record	1

29 institutions · 526 of 936 vouchered records shown · 6 without an institution code

09Environmental DNA19 detections

Where the DNA of Alvania punctura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys4

Countries3

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

Marine Protected Area; protected; 9.2 - Subt…Industrial port; industrial; 9.4 - Subtidal …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.70–17.0

Seasonal swing summer↔winter17.1 °C

Max temp (day)13.1 °C 6.80–19.0

Min temp (night)7.50 °C 2.90–14.8

Precipitation84.0 mm/mo 50.2–200

Air humidity61.7 % 59.5–64.7

Moisture balance30.2 mm/mo

Vapour deficit482 Pa 345–745

Wind speed5.00 m/s

Cloud cover50.3 % 41.3–61.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alvania punctura

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type2 169 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 169 records