Aporrhais serresiana

(Michaud, 1828) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Aporrhaidae/Aporrhais

At a glance

Occurrence records2 471

Data sources9

Biological traits5

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Aporrhais serresiana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 267 records↗

OBISOcean Biodiversity Information System1 204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS2 471 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD4 specimens

Genome at a glanceGoaT · NCBI≈849 Mbp

01Narrative

Aporrhais serresiana is a species of medium-sized sea snail, a marine gastropod mollusk in the family Aporrhaidae, the pelican's foot snails or pelican's foot shells.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max749 m

Depth min749 m

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aporrhais serresiana has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACTTTATATATTTTATTTGGTATATGATCTGGATTAGTTGGGACTGCCTTAAGACTTTTAATTCGAGCAGAGTTAGGACAACCAGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aporrhais pespelecanisame genus5.9%Amphissa reticulatasame order12.3%Laguncula pulchellasame order13.1%Onustus caribaeussame order13.7%Indothais sacellumsame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_059920 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6ND1ND6CYTBND4LND4ND5COX3ND3ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aporrhais serresiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈849 064 568 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aporrhais serresiana0.85 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 471 records

Wild obs. + sensor497

Museum / vouchered1 555

Fossil1

Other418

Range

Area of Occupancy AOO3 288 km²

Depth

0–200 m sunlit802

200–1000 m twilight250

1–4 km midnight2

>4 km abyssal0

median 128.8 m · max 2 800 m · 1 054 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 267≤1 km 14≤10 km 5>10 km 1

287 georeferenced · 210 without coordinates

Open the mapobservation + sensor497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 28≤1 km 21≤10 km 28>10 km 23

100 georeferenced · 1 455 without coordinates

Open the institutions mapphysical evidence1 555

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	86
ICATMARlocation not on record	53
Frankfurt am Main	36
CEFASlocation not on record	22
Natural History Museum Rotterdamlocation not on record	22
Bergen, NO	20
NTNU-VMlocation not on record	17
Brussels, BE	7
DASSHlocation not on record	7
Cambridge, US	6
Barcelona, ES	6
Santa Barbara Museum of Natural Historylocation not on record	5
Paris, FR	5
RBINS-Scientific Heritagelocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Toronto, CA	3
Norwegian Institute of Marine Researchlocation not on record	3
NHMOlocation not on record	3
P. P. Shirshov Institute of Oceanologylocation not on record	3
Philadelphia, US	2
Gothenburg, SE	2
Bergen, NO	2
IEO-COMA-CSIClocation not on record	2
ICMlocation not on record	2
AUTHlocation not on record	2
Denver, US	2
Provincia di Livornolocation not on record	1
MHN-UPlocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
630location not on record	1
Museo Enrico Pirajno di Mandralisca \| Enrico Pirajno di Mandralisca Museumlocation not on record	1
Deutsches Zentrum fuer Marine Biodiversitaetsforschunglocation not on record	1
ELMClocation not on record	1
Copenhagen, DK	1
Tromsø, NO	1
Delaware Museum of Nature and Sciencelocation not on record	1
Paleontological Research Institutionlocation not on record	1
PNHSlocation not on record	1
Seattle, US	1

39 institutions · 338 of 1 555 vouchered records shown · 547 without an institution code

09Environmental DNA2 detections

Where the DNA of Aporrhais serresiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aporrhais serresiana

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 471 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 471 records