Alucita hexadactyla

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Alucitidae/Alucita

At a glance

Occurrence records37 373

Data sources10

Biological traits2

DNA specimens44

eDNA detections70

Sources10 archives

Databases and archives Alucita hexadactyla's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 373 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF37 373 records

Environmental DNA3 datasets · 9 countries70 detections

DNA & barcodingBOLD44 specimens

Genome at a glanceGoaT · NCBI≈879 Mbp

01Narrative

Alucita hexadactyla (twenty-plume moth) is a "micromoth" of the many-plumed moth family (Alucitidae). It is found in Eurasia. It was previously thought to also occur in North America, but a 2004 study showed that the North American species are distinct and separate.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alucita hexadactyla has left across the world's sequence archives.

At a glance

DNA specimens44

BINs1

Marker genes2

eDNA detections70

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

85Amostly conserved

220Gmostly conserved

631Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCCGGCTTACTAGGAACATCTCTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes8

BIN1

Most divergent pair0.61%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alucita bidentatasame genus4.2%Alucita cancellatasame genus7.8%Alucita montanasame genus8.1%Alucita grammodactylasame genus8.7%Alucita desmodactylasame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Alucita hexadactyla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈878 530 053 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alucita hexadactyla0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.1% BUSCO

08Occurrence & distribution

Record type37 373 records

Wild obs. + sensor36 538

Museum / vouchered830

Other5

Origin

Native11

Range

Area of Occupancy AOO30 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 14 494≤1 km 3 407≤10 km 14 826>10 km 180

32 907 georeferenced · 3 631 without coordinates

Open the mapobservation + sensor36 538

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 541≤1 km 97≤10 km 98>10 km 1

737 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence830

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	486
NHMOlocation not on record	93
NTNU-VMlocation not on record	48
Nijmegen, NL	30
SLU Artdatabankenlocation not on record	24
CBDClocation not on record	23
University of Alberta Museums (UAM)location not on record	17
Natural History Museum Rotterdamlocation not on record	14
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	11
Stockholm, SE	9
Tartu, EE	6
Durban Natural Science Museumlocation not on record	5
New Haven, US	5
San Diego, US	4
BioFokuslocation not on record	3
University of Kaiserslauternlocation not on record	3
neflocation not on record	2
Naturalis Biodiversity Centerlocation not on record	2
NMBU:MINAlocation not on record	2
Universite de Montpellierlocation not on record	2
NCMGlocation not on record	2
South Kensington, GB	2
Provincia di Livornolocation not on record	1
Natural History Museum, Londonlocation not on record	1
Metsähallituslocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Brussels, BE	1

27 institutions · 798 of 830 vouchered records shown · 32 without an institution code

09Environmental DNA70 detections

Where the DNA of Alucita hexadactyla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys3

Countries9

Verifiable raw sequence linked31

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map9 countries0

Garden centre

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 6.00–17.1

Seasonal swing summer↔winter17.5 °C

Max temp (day)15.1 °C 10.1–20.9

Min temp (night)7.00 °C 1.90–13.6

Precipitation62.0 mm/mo 45.7–103

Air humidity60.3 % 58.3–63.0

Moisture balance-18.5 mm/mo -60.8–42.6

Vapour deficit559 Pa 373–777

Wind speed3.70 m/s 2.50–5.10

Cloud cover47.3 % 35.8–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alucita hexadactyla

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type37 373 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type37 373 records