Alucita desmodactyla

Zeller, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Alucitidae/Alucita

At a glance

Occurrence records163

Data sources8

Biological traits0

DNA specimens28

eDNA detections24

Sources8 archives

Databases and archives Alucita desmodactyla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF163 records

Environmental DNA1 datasets · 5 countries24 detections

DNA & barcodingBOLD28 specimens

01Narrative

Alucita desmodactyla is a moth of the family Alucitidae. It is found in most of Europe, except Ireland, Great Britain, the Benelux, Portugal, Denmark, Fennoscandia, the Baltic region and most of the Balkan Peninsula.Fauna Europaea It has also been recorded from Armenia and Tunisia. The habitat ranges from slope steppes to fresh deciduous woodlands on altitudes between 90 and 600 meters. Adults are on wing from the end July to early December and (after hibernation) from March to June. The larvae feed on Stachys recta, the flowers of Stachys alpina and Stachys sylvatica.Provisional atlas and checklist of the Alucitidae fauna of Hungary (Lepidoptera)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alucita desmodactyla has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes1

eDNA detections24

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

55Tmostly conserved

82Tmostly conserved

148Gmostly conserved

163Tmostly conserved

211Amostly conserved

212Tmostly conserved

214Gmostly conserved

220Tvariable

274Cmostly conserved

292Cmostly conserved

364Tmostly conserved

412Cmostly conserved

418Cmostly conserved

581Cmostly conserved

610Tmostly conserved

622Amostly conserved

625Gmostly conserved

628Amostly conserved

655Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTTTATTAGGAACATCCCTTAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes6

BINs2

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alucita pectinatasame genus4.1%Alucita majorsame genus4.6%Alucita ibericasame genus4.7%Alucita helenasame genus5.0%Alucita grammodactylasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type163 records

Wild obs. + sensor85

Museum / vouchered29

Other49

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 13≤1 km 19≤10 km 12>10 km 1

45 georeferenced · 40 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 1≤1 km 6≤10 km 10>10 km 2

19 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	12
Provincia di Livornolocation not on record	5
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Salzburg, AT	1
Bavarian State Collection of Zoologylocation not on record	1

6 institutions · 25 of 29 vouchered records shown · 4 without an institution code

09Environmental DNA24 detections

Where the DNA of Alucita desmodactyla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 7.90–20.1

Seasonal swing summer↔winter19.5 °C

Max temp (day)16.4 °C 11.8–24.5

Min temp (night)7.20 °C 1.90–14.2

Precipitation142 mm/mo 49.8–239

Air humidity61.6 % 55.4–64.2

Moisture balance27.6 mm/mo -114–142

Vapour deficit566 Pa 383–950

Wind speed2.20 m/s 1.60–4.50

Cloud cover37.7 % 32.7–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)