Alticus montanoi

(Sauvage, 1880) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Blenniidae/Alticus

At a glance

Occurrence records43

Data sources9

Biological traits4

DNA specimens11

eDNA detections0

Sources9 archives

Databases and archives Alticus montanoi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

OBISOcean Biodiversity Information System14 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS43 records

DNA & barcodingBOLD11 specimens

01Narrative

Alticus montanoi, Montano's rockskipper, is a species of combtooth blenny (family Blenniidae) in the genus Alticus.Alticus montanoi at www.fishbase.org. It is a tropical blenny, and is known from the South China Sea, in the western Pacific Ocean. The blennies are oviparous, and form distinct pairs when mating.Reproduction summary for Alticus montanoi at www.fishbase.org. They feed primarily off of benthic algae.Food items reported for Alticus montanoi at www.fishbase.org. The specific name honors the collector of the type, the French ethnologist Joseph Montaro.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits1

Vulnerability10

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alticus montanoi has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P600 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

291Gvariable

378Gmostly conserved

588Tmostly conserved

GCCTTGAGCCTACTCATTCGAGCAGAATTAAGCCAACCAGGGGCTCTCCTCGGAGATGACCAAATCTATAATGTAATCGTTACGGCCCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes3

BIN1

Most divergent pair0.33%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alticus orientalissame genus4.2%Alticus monochrussame genus4.5%Andamia reyisame family13.7%Andamia tetradactylussame family14.5%Praealticus striatussame family16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor11

Museum / vouchered32

Range

Area of Occupancy AOO84 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 17.5 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 1

10 georeferenced · 1 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	15
Paris, FR	1
CASlocation not on record	1
Chicago, US	1

4 institutions · 18 of 32 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)