Alticus monochrus

Bleeker, 1869 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Blenniidae/Alticus

At a glance

Occurrence records208

Data sources10

Biological traits6

DNA specimens8

eDNA detections8

Sources10 archives

Databases and archives Alticus monochrus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility175 records↗

OBISOcean Biodiversity Information System33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS208 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Alticus monochrus is a species of combtooth blenny (family Blenniidae) in the genus Alticus. It is a tropical blenny found in the western Indian Ocean including the Comoros Mozambique, Madagascar, the Seychelles and the Mascarene Islands. It can reach a maximum total length of 10 centimetres (3.94 inches).Alticus monochrus at www.fishbase.org.Alticus monochrus at www.fishwise.co.za. The blennies feed primarily off of benthic algae.Food items reported for Alticus monochrus at www.fishbase.org. They are oviparous. Alticus monochrus observed in Mauritius

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alticus monochrus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes2

BINs2

Most divergent pair0.61%

Where individuals differ — all 36 variable positions, in barcode order

7Cmostly conserved

11Amostly conserved

15Amostly conserved

21Tmostly conserved

36Amostly conserved

39Amostly conserved

48Gmostly conserved

76Cmostly conserved

93Tmostly conserved

96Tmostly conserved

102Gmostly conserved

105Cmostly conserved

114Tmostly conserved

168Amostly conserved

201Amostly conserved

234Cmostly conserved

273Cmostly conserved

286Tmostly conserved

294Gmostly conserved

324Gmostly conserved

351Gmostly conserved

426Gmostly conserved

465Tmostly conserved

477Amostly conserved

495Gmostly conserved

498Cmostly conserved

504Gmostly conserved

519Tmostly conserved

576Amostly conserved

585Tmostly conserved

633Gmostly conserved

639Gmostly conserved

651Amostly conserved

652Cmostly conserved

653Amostly conserved

654Cmostly conserved

GGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGAATAGTAGGAACGGCTTTGAGCCTACTCATTCGAGCAGAACTAAGCCAACCAGGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alticus orientalissame genus4.0%Alticus salienssame genus4.3%Alticus montanoisame genus4.5%Andamia reyisame family12.5%Sebastes thompsonisame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type208 records

Wild obs. + sensor159

Museum / vouchered49

Origin

Native1

Range

Area of Occupancy AOO392 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 5 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 82≤1 km 31≤10 km 10>10 km 8

131 georeferenced · 28 without coordinates

Open the mapobservation + sensor159

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 3≤10 km 15

18 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	6
South African Institute for Aquatic Biodiversitylocation not on record	6
Washington, US	4
Paris, FR	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Los Angeles, US	1
Frankfurt am Main	1

7 institutions · 22 of 49 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Alticus monochrus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)