Alpheus polystictus

Knowlton & Keller, 1985 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records19

Data sources6

Biological traits2

DNA specimens17

eDNA detections17

Sources6 archives

Databases and archives Alpheus polystictus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS19 records

Environmental DNA1 datasets · 0 countries17 detections

DNA & barcodingBOLD17 specimens

01Narrative

Alpheus polystictus is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1985 door Knowlton & Keller.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus polystictus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P546 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

66Cmostly conserved

138Cmostly conserved

243Tmostly conserved

258Amostly conserved

445Cmostly conserved

528Tmostly conserved

534Cmostly conserved

TATAATGTAATTGTCACTGCCCACGCCTTTGTTATAATCTTCTTTATGGTTATACCAATTATAATCGGAGGATTTGGAAACTGACTAGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes6

BIN1

Most divergent pair0.55%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus roquensissame genus6.6%Alpheus armatussame genus11.2%Alpheus immaculatussame genus11.9%Alpheus hippothoesame genus17.0%Synalpheus tumidomanussame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor9

Museum / vouchered10

Range

Area of Occupancy AOO52 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 2 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 2≤10 km 3>10 km 4

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	7
FCMMlocation not on record	1

2 institutions · 8 of 10 vouchered records shown · 1 without an institution code

09Environmental DNA17 detections

Where the DNA of Alpheus polystictus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)