Alpheus armatus

M.J.Rathbun, 1901 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records226

Data sources8

Biological traits4

DNA specimens16

eDNA detections16

Sources8 archives

Databases and archives Alpheus armatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility190 records↗

OBISOcean Biodiversity Information System36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS226 records

Environmental DNA1 datasets · 0 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Alpheus armatus is a species of snapping shrimp in the family Alpheidae, found in shallow water in the Caribbean Sea and the Gulf of Mexico. It lives in association with a sea anemone such as Bartholomea annulata, clearing out sand from the cracks and crevices in which the sea anemone often lives.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Other traits2

Depth max2 m

Depth min0 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus armatus has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P525 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

12Cmostly conserved

57Avariable

111Cmostly conserved

117Amostly conserved

129Amostly conserved

141Amostly conserved

150Amostly conserved

154Cmostly conserved

156Gmostly conserved

159Tmostly conserved

216Gvariable

243Cmostly conserved

294Tmostly conserved

339Cmostly conserved

363Avariable

372Cmostly conserved

429Gmostly conserved

447Gmostly conserved

510Amostly conserved

TATAACGTAATCGTTACCGCTCATGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAACTGACTAGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.72%

Haplotypes9

BIN1

Most divergent pair1.9%

OtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus immaculatussame genus8.8%Alpheus roquensissame genus9.5%Alpheus polystictussame genus11.2%Demania baccalipessame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor113

Museum / vouchered113

Origin

Native3

Range

Area of Occupancy AOO480 km²

Depth

0–200 m sunlit17

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.5 m · max 60.5 m · 17 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 9≤1 km 10≤10 km 7>10 km 10

36 georeferenced · 77 without coordinates

Open the mapobservation + sensor113

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 12≤1 km 3≤10 km 2>10 km 1

18 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	16
Mexico City, MX	15
	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
UM-RSMASlocation not on record	5
Paris, FR	5
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	4
FCMMlocation not on record	4
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	3
Texas Cooperative Wildlife Collectionlocation not on record	3
Cambridge, US	1
San Nicolás de los Garza, MX	1
Fundacion La Salle- Margarita- Venezuelalocation not on record	1

13 institutions · 77 of 113 vouchered records shown · 9 without an institution code

09Environmental DNA16 detections

Where the DNA of Alpheus armatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)