Alpheus clypeatus

Coutière, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records151

Data sources5

Biological traits4

DNA specimens8

eDNA detections12

Sources5 archives

Databases and archives Alpheus clypeatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility115 records↗

OBISOcean Biodiversity Information System36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS151 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max80 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus clypeatus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TACCTTATACTTCATCTTCGGCGCTTGAGCCGGAATAGTTGGCACGGCACTCAGACTTCTAATCCGTGCCGAGCTCGGCCAACCAGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus bucephalussame genus17.2%Alpheus strenuussame genus17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type151 records

Wild obs. + sensor6

Museum / vouchered144

Other1

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	44
Washington, US	23
Honolulu, US	17
Paris, FR	16
University of Floridalocation not on record	6
Cambridge, US	1

6 institutions · 107 of 144 vouchered records shown · 1 without an institution code

09Environmental DNA12 detections

Where the DNA of Alpheus clypeatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

reef frontouter reef slopevolcanic rocky shore and fringing flat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 20.1–25.7

Seasonal swing summer↔winter3.90 °C

Max temp (day)25.0 °C 22.7–31.2

Min temp (night)21.8 °C 18.1–22.6

Precipitation82.3 mm/mo 50.7–117

Air humidity59.7 % 56.9–71.8

Vapour deficit1,166 Pa 663–1,423

Cloud cover33.5 % 24.9–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)