Alpheus bucephalus

Coutière, 1905 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records194

Data sources6

Biological traits4

DNA specimens10

eDNA detections21

Sources6 archives

Databases and archives Alpheus bucephalus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility134 records↗

OBISOcean Biodiversity Information System60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS194 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD10 specimens

01Narrative

Alpheus bucephalus is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1905 door Coutière.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max80 m

Depth min0 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus bucephalus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 93 variable positions, in barcode order

3Tmostly conserved

15Tmostly conserved

21Gmostly conserved

24Tmostly conserved

27Avariable

33Amostly conserved

45Gvariable

54Tmostly conserved

60Gmostly conserved

72Avariable

87Cvariable

90Gmostly conserved

91Tmostly conserved

99Gvariable

102Tmostly conserved

108Amostly conserved

114Cmostly conserved

120Gmostly conserved

123Cvariable

129Gvariable

150Cmostly conserved

159Gmostly conserved

162Tvariable

165Amostly conserved

171Tmostly conserved

180Avariable

189Tmostly conserved

195Amostly conserved

201Avariable

207Cmostly conserved

216Gmostly conserved

219Tvariable

228Amostly conserved

237Amostly conserved

240Tmostly conserved

255Gvariable

261Amostly conserved

264Cmostly conserved

270Tmostly conserved

277Tmostly conserved

279Amostly conserved

282Cmostly conserved

288Tmostly conserved

291Cmostly conserved

297Gvariable

300Gmostly conserved

301Cmostly conserved

315Gvariable

318Tmostly conserved

321Amostly conserved

324Gmostly conserved

327Gmostly conserved

357Cmostly conserved

360Tmostly conserved

366Cmostly conserved

369Gmostly conserved

372Amostly conserved

375Tvariable

378Cvariable

387Tvariable

393Tmostly conserved

399Cmostly conserved

411Tmostly conserved

417Avariable

432Amostly conserved

435Amostly conserved

450Cvariable

453Amostly conserved

456Amostly conserved

459Tmostly conserved

462Cmostly conserved

465Gvariable

468Cmostly conserved

471Gmostly conserved

474Amostly conserved

477Amostly conserved

483Tmostly conserved

498Tmostly conserved

513Tmostly conserved

525Amostly conserved

528Amostly conserved

537Amostly conserved

543Tmostly conserved

549Amostly conserved

555Cvariable

564Avariable

570Tmostly conserved

573Tmostly conserved

600Tmostly conserved

612Cmostly conserved

618Amostly conserved

621Cmostly conserved

633Tvariable

ACTCTATACTTTATTTTTGGGGCTTGAGCCGGAATAGTAGGCACGGCCCTAAGTCTCCTGATCCGAGCCGAACTTGGTCAACCAGGCAGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes5

BINs2

Most divergent pair12.7%

OtherAsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus euphrosynesame genus15.9%Alpheus strenuussame genus16.1%Alpheus pareuchirussame genus16.1%Alpheus cristulifronssame genus16.7%Alpheus floridanussame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type194 records

Wild obs. + sensor15

Museum / vouchered178

Other1

Range

Area of Occupancy AOO344 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6 m · max 22.5 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤1 km 6>10 km 5

11 georeferenced · 4 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 4≤1 km 17≤10 km 11

32 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence178

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	42
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	21
Natick, US	13
Museum and Art Gallery of the Northern Territorylocation not on record	9
Stockholm, SE	8
Honolulu, US	6
Sydney, AU	6
Paris, FR	5
	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
University of Floridalocation not on record	1
Western Australian Museumlocation not on record	1
Frankfurt am Main	1

13 institutions · 118 of 178 vouchered records shown · 7 without an institution code

09Environmental DNA21 detections

Where the DNA of Alpheus bucephalus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 23.4–26.0

Seasonal swing summer↔winter2.20 °C

Max temp (day)27.2 °C 23.8–27.6

Min temp (night)24.2 °C 22.9–24.9

Precipitation260 mm/mo 19.2–297

Air humidity68.5 % 59.1–68.9

Moisture balance113 mm/mo

Vapour deficit1,025 Pa 1,020–1,191

Wind speed1.20 m/s

Cloud cover55.3 % 37.1–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)