Alpheus angulosus

McClure, 2002 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records223

Data sources7

Biological traits4

DNA specimens137

eDNA detections122

Sources7 archives

Databases and archives Alpheus angulosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

OBISOcean Biodiversity Information System50 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI122 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics137 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS223 records

Environmental DNA1 datasets · 2 countries122 detections

DNA & barcodingBOLD137 specimens

01Narrative

Alpheus angulosus is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2002 door McClure.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max2 m

Depth min0 m

05DNA & barcoding137 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus angulosus has left across the world's sequence archives.

At a glance

DNA specimens137

BINs2

Marker genes3

eDNA detections122

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

58Tvariable

73Gvariable

79Cvariable

94Amostly conserved

100Avariable

112Cmostly conserved

181Tmostly conserved

211Avariable

220Gvariable

268Tvariable

271Tvariable

283Tmostly conserved

286Cmostly conserved

325Cvariable

337Cvariable

340Cmostly conserved

352Avariable

400Amostly conserved

499Tmostly conserved

529Tvariable

556Avariable

578Tmostly conserved

581Cmostly conserved

592Avariable

607Cvariable

625Amostly conserved

652Tmostly conserved

TACTCTATATTTTATTTTTGGAGCCTGAGCTGGTATAGTAGGAACTGCCCTTAGTCTTTTAATTCGAGCTGAGCTAGGCCAACCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes6

BINs2

Most divergent pair2.9%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus mathewsaesame genus7.8%Alpheus armillatussame genus13.4%Alpheus colombiensissame genus14.3%Alpheus paracrinitussame genus15.3%Alpheus pacificussame genus16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type223 records

Wild obs. + sensor26

Museum / vouchered197

Range

Area of Occupancy AOO244 km²

Depth

0–200 m sunlit30

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 8 m · 30 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 6≤10 km 4>10 km 8

18 georeferenced · 8 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	33
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	29
FCMMlocation not on record	26
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	15
San Nicolás de los Garza, MX	3
Paris, FR	2
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	1

7 institutions · 109 of 197 vouchered records shown · 18 without an institution code

09Environmental DNA122 detections

Where the DNA of Alpheus angulosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found122

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 122 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 12.5–23.0

Seasonal swing summer↔winter27.0 °C

Max temp (day)28.2 °C 18.4–28.2

Min temp (night)18.2 °C 8.20–18.2

Precipitation146 mm/mo 79.6–146

Air humidity58.3 % 57.3–58.3

Moisture balance-49.4 mm/mo -49.4–-38.4

Vapour deficit1,168 Pa 733–1,168

Wind speed5.50 m/s 5.50–5.80

Cloud cover33.8 % 33.8–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)