Alopecosa sulzeri

(Pavesi, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records644

Data sources7

Biological traits8

DNA specimens14

eDNA detections9

Sources7 archives

Databases and archives Alopecosa sulzeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility644 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

World Spider Trait DBMasaryk University8 traits · 14 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements14 literature sources8 traits

Occurrence & distributionGBIF644 records

Environmental DNA1 datasets · 4 countries9 detections

DNA & barcodingBOLD14 specimens

01Narrative

Alopecosa sulzeri est une espèce d'araignées aranéomorphes de la famille des Lycosidae.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 14 sources

LGBl 2007LGBl 2015Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Komposch & Steinberger 1999Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Liste France 2018Noflatscher 1994Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀16.5·♂11 mm

Predation1

Hunting guildground hunters

Ecology6

Legal protectionYes

Light0.75 mm

Light 2partly shaded

Moisture 2dry

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryEndangered (2)

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa sulzeri has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections9

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes1

BIN1

Where individuals differ — all 22 variable positions, in barcode order

1Gvariable

19Gvariable

73Amostly conserved

112Avariable

145Tmostly conserved

148Gmostly conserved

160Amostly conserved

163Tmostly conserved

169Amostly conserved

173Cmostly conserved

175Tmostly conserved

181Tmostly conserved

184Tmostly conserved

190Tmostly conserved

217Gvariable

223Tvariable

265Amostly conserved

352Avariable

439Gmostly conserved

458Gvariable

562Gmostly conserved

592Gvariable

GACTTTGTATTTAATATTGGGTGTTTGGTCAGCAATAATAGGTACTGCTATATCAGTATTAATTCGAATGGAATTAGGTAATCCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa albostriatasame genus4.9%Alopecosa solivagasame genus5.0%Alopecosa hirtipessame genus5.1%Alopecosa sibiricasame genus5.3%Alopecosa koponenisame genus5.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type644 records

Wild obs. + sensor485

Museum / vouchered139

Other20

Origin

Native178

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 46≤1 km 1≤10 km 382>10 km 1

430 georeferenced · 55 without coordinates

Open the mapobservation + sensor485

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 4≤1 km 25≤10 km 8>10 km 3

40 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	64
Ekaterinburg, RU	19
Provincia di Livornolocation not on record	7
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	4
Prioksko-Terrasnyi Biosphere Reservelocation not on record	3
Centre for Biodiversity Genomicslocation not on record	3
Washington, US	3
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	3
Frankfurt am Main	2
Hungarian Natural History Museumlocation not on record	1

10 institutions · 109 of 139 vouchered records shown · 30 without an institution code

09Environmental DNA9 detections

Where the DNA of Alopecosa sulzeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.9–17.5

Seasonal swing summer↔winter20.5 °C

Max temp (day)20.6 °C 17.8–21.3

Min temp (night)9.90 °C 8.20–12.2

Precipitation89.1 mm/mo 67.1–114

Air humidity57.8 % 57.2–61.9

Moisture balance-39.7 mm/mo -44.7–5.30

Vapour deficit781 Pa 663–838

Wind speed2.20 m/s 2.20–2.60

Cloud cover33.0 % 33.0–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)