Alopecosa pictilis

(Emerton, 1885) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Alopecosa

At a glance

Occurrence records38

Data sources7

Biological traits3

DNA specimens17

eDNA detections0

Sources7 archives

Databases and archives Alopecosa pictilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 records↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF38 records

DNA & barcodingBOLD17 specimens

01Narrative

Alopecosa pictilis is a species of wolf spider in the family Lycosidae. It is found in North America and Russia (Sibiria).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀10.45·♂8.55 mm

Cephalothorax length♀4.46·♂4.42 mm

Cephalothorax width♀3.31·♂3.35 mm

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecosa pictilis has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

40Gmostly conserved

76Amostly conserved

211Gvariable

550Gmostly conserved

557Cmostly conserved

GACTTTGTATTTAATGTTAGGTGTTTGGTCAGCAATGATGGGTACTTCTATATCAGTATTAATTCGTATGGAATTAGGTAATCCTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alopecosa sibiricasame genus2.7%Alopecosa hirtipessame genus4.6%Alopecosa solivagasame genus4.7%Alopecosa koponenisame genus4.9%Alopecosa albostriatasame genus5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor12

Museum / vouchered26

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 7≤1 km 2>10 km 1

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 11≤10 km 1

12 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Vancouver, CA	3
Cambridge, US	1

4 institutions · 20 of 26 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)