Allygus modestus

Scott, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Allygus

At a glance

Occurrence records846

Data sources6

Biological traits2

DNA specimens23

eDNA detections88

Sources6 archives

Databases and archives Allygus modestus's data was compiled from.

GBIFGlobal Biodiversity Information Facility846 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI88 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF846 records

Environmental DNA3 datasets · 9 countries88 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceNCBI≈1.8 Gbp

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allygus modestus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections88

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.23%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

602Amostly conserved

644Tmostly conserved

CAATATACTTTATCTTTGGGATTTGATCAGGTATAGTAGGAATAATACTTAGAATGATTATTCGAATTGAATTAGCTCAACCAGGTTCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allygus mixtussame genus14.1%Aconurella sibiricasame family17.3%Scaphoideus cylindratussame family17.5%Selenocephalus obsoletussame family17.6%Cosmotettix unicussame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Allygus modestus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 819 865 731 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Allygus modestus1.82 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type846 records

Wild obs. + sensor830

Museum / vouchered16

Range

Area of Occupancy AOO2 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 259≤1 km 103≤10 km 247>10 km 8

617 georeferenced · 213 without coordinates

Open the mapobservation + sensor830

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 6

9 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	3
SLU Artdatabankenlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	1
South Kensington, GB	1
Bonn, DE	1
Natural History Museum, Rangoonlocation not on record	1

6 institutions · 10 of 16 vouchered records shown · 6 without an institution code

09Environmental DNA88 detections

Where the DNA of Allygus modestus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found88

Studies independent surveys3

Countries9

Verifiable raw sequence linked61

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 88 detections have coordinates

Open the map9 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 12.7–17.2

Seasonal swing summer↔winter16.9 °C

Max temp (day)18.9 °C 15.9–20.8

Min temp (night)12.4 °C 10.1–14.5

Precipitation67.4 mm/mo 48.4–84.1

Air humidity60.7 % 60.2–64.2

Moisture balance-53.9 mm/mo -72.3–11.3

Vapour deficit724 Pa 521–779

Wind speed4.20 m/s 3.60–4.70

Cloud cover41.0 % 38.9–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)