Allygus mixtus

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Allygus

At a glance

Occurrence records2 585

Data sources6

Biological traits2

DNA specimens55

eDNA detections1 039

Sources6 archives

Databases and archives Allygus mixtus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 585 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 039 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics55 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 585 records

Environmental DNA4 datasets · 7 countries1 039 detections

DNA & barcodingBOLD55 specimens

01Narrative

Allygus mixtus is a species of true bug belonging to the family Cicadellidae. Synonyms: Cicada mixtus Fabricius, 1794 (= basionym) Jassus corisipennis Ferrari, 1882 Allygus alticola Horvath, 1903

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding55 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allygus mixtus has left across the world's sequence archives.

At a glance

DNA specimens55

BINs2

Marker genes1

eDNA detections1 039

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus53 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

1Cmostly conserved

3Amostly conserved

4Tmostly conserved

5Amostly conserved

7Amostly conserved

11Cmostly conserved

12Amostly conserved

15Tmostly conserved

17Tmostly conserved

18Gmostly conserved

21Amostly conserved

22Tmostly conserved

23Cmostly conserved

27Tmostly conserved

28Cmostly conserved

31Gmostly conserved

33Amostly conserved

39Gmostly conserved

40Gmostly conserved

48Cmostly conserved

50Amostly conserved

52Gmostly conserved

56Amostly conserved

62Tmostly conserved

63Cmostly conserved

64Gmostly conserved

66Amostly conserved

68Tmostly conserved

70Amostly conserved

72Cmostly conserved

73Tmostly conserved

74Gmostly conserved

77Cmostly conserved

173Amostly conserved

179Tmostly conserved

215Gmostly conserved

218Amostly conserved

341Tmostly conserved

368Gmostly conserved

479Amostly conserved

494Tmostly conserved

545Tmostly conserved

572Gvariable

CAATATACTTCATTTTTGGAATCTGATCAGGAATAGTAGGAATAATACTAAGAATAATTATTCGAATTGAACTGGCCCAACCAGGATCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes5

BINs2

Most divergent pair7.8%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allygus modestussame genus14.1%Nephotettix cincticepssame family17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 585 records

Wild obs. + sensor2 284

Museum / vouchered270

Other31

Range

Area of Occupancy AOO6 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 309≤1 km 406≤10 km 319>10 km 7

2 041 georeferenced · 243 without coordinates

Open the mapobservation + sensor2 284

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 89≤1 km 55≤10 km 20

164 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	53
SLU Artdatabankenlocation not on record	48
University of Guelph, Centre for Biodiversity Genomicslocation not on record	25
Museo universitario di Scienze della Terra di Romalocation not on record	15
Philadelphia, US	15
Stockholm, SE	8
Metsähallituslocation not on record	8
CBDClocation not on record	4
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
neflocation not on record	4
BioFokuslocation not on record	2
Helsinki, FI	2
Tromsø, NO	2
Tilburg, NL	2
Bavarian State Collection of Zoologylocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Tartu, EE	1
Bonn, DE	1

18 institutions · 197 of 270 vouchered records shown · 73 without an institution code

09Environmental DNA1 039 detections

Where the DNA of Allygus mixtus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 039

Studies independent surveys4

Countries7

Verifiable raw sequence linked986

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 039 detections have coordinates

Open the map7 countries0

WetlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.8–17.2

Seasonal swing summer↔winter17.8 °C

Max temp (day)20.0 °C 15.2–21.4

Min temp (night)12.8 °C 9.20–13.8

Precipitation67.4 mm/mo 54.7–99.6

Air humidity61.5 % 59.2–64.2

Moisture balance-27.3 mm/mo -70.9–11.2

Vapour deficit697 Pa 507–808

Wind speed3.60 m/s 2.50–4.70

Cloud cover45.2 % 39.8–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 1 038 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allygus mixtus

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type2 585 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 585 records