Allotria elonympha

Hübner, 1818 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Allotria

At a glance

Occurrence records3 163

Data sources7

Biological traits0

DNA specimens43

eDNA detections45

Sources7 archives

Databases and archives Allotria elonympha's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 163 records

Environmental DNA1 datasets · 1 countries45 detections

DNA & barcodingBOLD43 specimens

01Narrative

Allotria is a monotypic moth genus in the family Erebidae. Its only species, Allotria elonympha, the false underwing moth, is found in eastern North America. Both the genus and the species were first described by Jacob Hübner, the genus in 1823 and the species in 1818. The wingspan is 33–44 mm. Adults are on wing from March to September. The larvae feed on various deciduous trees, such as black gum (Nyssa sylvatica), hickory and walnut.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allotria elonympha has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes2

eDNA detections45

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

250Tmostly conserved

433Gmostly conserved

505Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACATCACTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.13%

Haplotypes6

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cutina albopunctellasame family5.6%Gondysia similissame family5.9%Argyrostrotis deletasame family6.1%Argyrostrotis anilissame family6.2%Achaea atrimaculasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type3 163 records

Wild obs. + sensor2 507

Museum / vouchered656

Range

Area of Occupancy AOO5 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 1 185≤1 km 400≤10 km 179>10 km 247

2 011 georeferenced · 496 without coordinates

Open the mapobservation + sensor2 507

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 16≤1 km 84≤10 km 269>10 km 25

394 georeferenced · 262 without coordinates

Open the institutions mapphysical evidence656

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	192
Mississippi State, US	121
CUlocation not on record	72
Georgia Museum of Natural Historylocation not on record	46
East Lansing, US	44
Cambridge, US	42
Cleveland Museum of Natural History, OH (CLEV)location not on record	40
OSUClocation not on record	9
Colorado State Universitylocation not on record	8
Philadelphia, US	7
St. Paul, US	7
Toronto, CA	6
UDlocation not on record	5
Washington, US	5
San Diego, US	4
Natural History Museum of Utahlocation not on record	4
University of Alberta Museums (UAM)location not on record	3
Espace pour la vielocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Zürich, CH	1
UKY-HIClocation not on record	1
University of Alabamalocation not on record	1
North Carolina State University Insect Museumlocation not on record	1

23 institutions · 623 of 656 vouchered records shown · 33 without an institution code

09Environmental DNA45 detections

Where the DNA of Allotria elonympha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 14.2–23.7

Seasonal swing summer↔winter20.6 °C

Max temp (day)25.2 °C 19.6–28.4

Min temp (night)15.6 °C 8.80–20.1

Precipitation118 mm/mo 94.7–141

Air humidity59.7 % 57.4–60.9

Moisture balance-28.3 mm/mo -64.8–9.80

Vapour deficit975 Pa 669–1,189

Wind speed2.80 m/s 1.10–3.50

Cloud cover38.2 % 28.2–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allotria elonympha

At a glance

Sources7 archives

At a glance

Record type3 163 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 163 records