Argyrostrotis anilis

Drury, 1773 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Argyrostrotis

At a glance

Occurrence records1 218

Data sources7

Biological traits0

DNA specimens20

eDNA detections20

Sources7 archives

Databases and archives Argyrostrotis anilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 218 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD20 specimens

01Narrative

Argyrostrotis anilis, the short-lined chocolate, is a moth of the family Noctuidae. The species was first described by Dru Drury in 1773. It is found in North America from Quebec and Ontario, down through the eastern United States to Florida and Texas. It is listed as a species of special concern in the state of Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved January 19, 2018. The wingspan is about 25 mm. The larvae feed on Prunus americana.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyrostrotis anilis has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

154Cmostly conserved

199Amostly conserved

313Tmostly conserved

346Cmostly conserved

364Tmostly conserved

391Tmostly conserved

400Cmostly conserved

547Tmostly conserved

583Gmostly conserved

601Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes3

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gondysia similissame family4.7%Gondysia telmasame family4.9%Gondysia smithiisame family4.9%Dysgonia mandschurianasame family5.1%Argyrostrotis deletasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 218 records

Wild obs. + sensor783

Museum / vouchered435

Range

Area of Occupancy AOO2 732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 345≤1 km 120≤10 km 60>10 km 79

604 georeferenced · 179 without coordinates

Open the mapobservation + sensor783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 9≤1 km 87≤10 km 135>10 km 36

267 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence435

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	87
East Lansing, US	62
New Haven, US	46
King Saud Universitylocation not on record	46
Georgia Museum of Natural Historylocation not on record	33
Colorado State Universitylocation not on record	32
CUlocation not on record	22
Cleveland Museum of Natural History, OH (CLEV)location not on record	21
University of Alberta Museums (UAM)location not on record	14
Royal Saskatchewan Museumlocation not on record	14
St. Paul, US	10
Toronto, CA	6
Washington, US	5
UDlocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Cambridge, US	3
OSUClocation not on record	2
Denver, US	1
US	1
Universidad Católica de Manizaleslocation not on record	1

20 institutions · 414 of 435 vouchered records shown · 21 without an institution code

09Environmental DNA20 detections

Where the DNA of Argyrostrotis anilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

Backdune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 14.0–26.4

Seasonal swing summer↔winter20.0 °C

Max temp (day)26.0 °C 16.7–31.6

Min temp (night)15.4 °C 10.2–23.1

Precipitation107 mm/mo 78.4–140

Air humidity58.5 % 56.5–63.7

Moisture balance-41.9 mm/mo

Vapour deficit988 Pa 622–1,407

Wind speed3.90 m/s

Cloud cover36.6 % 31.2–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyrostrotis anilis

At a glance

Sources7 archives

At a glance

Record type1 218 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 218 records