Allomengea vidua

(L.Koch, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Allomengea

At a glance

Occurrence records1 352

Data sources7

Biological traits8

DNA specimens3

eDNA detections8

Sources7 archives

Databases and archives Allomengea vidua's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 352 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

World Spider Trait DBMasaryk University8 traits · 27 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements27 literature sources8 traits

Occurrence & distributionGBIF1 352 records

Environmental DNA3 datasets · 3 countries8 detections

DNA & barcodingBOLD3 specimens

01Narrative

Het klein stekelpalpje is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het dier behoort tot het geslacht Allomengea. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1879 door Ludwig Carl Christian Koch.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 27 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Staręga et al. 2001Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Finch 2004Kielhorn 2017Vangsgård et al. 1996Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Noflatscher 1994Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀4·♂3.35 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Light0.75 mm

Light 2semi-open

Moisture 10.875 mm

Moisture 2humid

Regional IUCN Red List categoryEndangered (EN)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allomengea vidua has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.81%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 8 variable positions, in barcode order

9Cvariable

15Tvariable

63Cvariable

345Gvariable

393Cvariable

402Avariable

472Tvariable

537Avariable

AGTTTATACTTCGTTTTTGGGGCTTGGGCTGCTATGGTAGGAACAGCAATAAGAGTTTTAATCCGTATCGAGTTAGGTCAAACTGGGAGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allomengea scopigerasame genus6.6%Allomengea dentisetissame genus7.6%Wubana drassoidessame family9.6%Oreonetides filicatussame family10.7%Styloctetor purpurescenssame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 352 records

Wild obs. + sensor904

Museum / vouchered448

Origin

Native49

Range

Area of Occupancy AOO1 580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 280≤1 km 99≤10 km 510>10 km 1

890 georeferenced · 14 without coordinates

Open the mapobservation + sensor904

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 22≤1 km 44≤10 km 151>10 km 6

223 georeferenced · 225 without coordinates

Open the institutions mapphysical evidence448

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	127
Helsinki, FI	111
Adam Mickiewicz University in Poznańlocation not on record	58
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	47
Uniwersytet w Białymstokulocation not on record	13
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	9
Tartu, EE	6
Ekaterinburg, RU	6
Bonn, DE	5
SLU Artdatabankenlocation not on record	4
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	4
Copenhagen, DK	3
Zoologisches Museum Hamburglocation not on record	2
Rovaniemi, FI	2
	2
MZLUlocation not on record	2
Akademia Pomorska w Słupskulocation not on record	1
Frankfurt am Main	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Chicago, US	1

20 institutions · 405 of 448 vouchered records shown · 43 without an institution code

09Environmental DNA8 detections

Where the DNA of Allomengea vidua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys3

Countries3

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

Schilf

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 9.10–17.4

Seasonal swing summer↔winter23.2 °C

Max temp (day)17.7 °C 12.3–20.5

Min temp (night)9.90 °C 5.80–14.0

Precipitation69.8 mm/mo 64.5–96.6

Air humidity61.0 % 57.3–63.0

Moisture balance17.9 mm/mo

Vapour deficit653 Pa 496–800

Wind speed2.40 m/s

Cloud cover49.1 % 40.7–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allomengea vidua

At a glance

Sources7 archives

Morphometry1

Predation1

Ecology6

At a glance

Record type1 352 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 352 records