Allomengea scopigera

(Grube, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Allomengea

At a glance

Occurrence records1 865

Data sources7

Biological traits8

DNA specimens35

eDNA detections38

Sources7 archives

Databases and archives Allomengea scopigera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 865 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

World Spider Trait DBMasaryk University8 traits · 23 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements23 literature sources8 traits

Occurrence & distributionGBIF1 865 records

Environmental DNA3 datasets · 6 countries38 detections

DNA & barcodingBOLD35 specimens

01Narrative

Het alert stekelpalpje is een spinnensoort in de taxonomische indeling van de hangmatspinnen (Linyphiidae). Het dier behoort tot het geslacht Allomengea. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1859 door Grube.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 23 sources

Entling et al. 2007Buchar & Růžička 2002Gajdoš & Svatoň 2001SLU 2020Henriksen & Hilmo 2015Harvey et al. 2017Hyvärinen et al. 2019Gajdoš et al. 2014Bruun & Lissner 2019Kielhorn 2017Finch 2004Vangsgård et al. 1996Martin 2012Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀4.75·♂4.2 mm

Predation1

Hunting guildsheet web weavers

Ecology6

Light0.75 mm

Light 2semi-open

Moisture 10.75 mm

Moisture 2humid

Regional IUCN Red List categoryCritically Endangered (CR)

Regional non-IUCN Red List categoryLeast Concern (*)

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allomengea scopigera has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections38

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

10Cmostly conserved

32Gmostly conserved

163Gmostly conserved

238Gmostly conserved

286Gvariable

367Tmostly conserved

451Cmostly conserved

478Tmostly conserved

480Tmostly conserved

484Tmostly conserved

496Tmostly conserved

508Amostly conserved

511Amostly conserved

517Cmostly conserved

535Amostly conserved

571Tmostly conserved

640Gmostly conserved

641Cmostly conserved

AAGTTTATACTTTATTTTTGGAGCTTGGGCTGCTATAGTAGGAACAGCAATAAGAGTTTTAATTCGTATTGAGTTAGGTCAAACTGGGAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.91%

Haplotypes11

BIN1

Most divergent pair2.3%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allomengea dentisetissame genus6.5%Allomengea viduasame genus6.6%Oreonetides filicatussame family10.3%Helophora orinomasame family10.6%Hybauchenidium gibbosumsame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 865 records

Wild obs. + sensor537

Museum / vouchered1 328

Range

Area of Occupancy AOO1 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 371≤1 km 120≤10 km 46

537 georeferenced

Open the mapobservation + sensor537

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 670≤1 km 294≤10 km 72>10 km 112

1 148 georeferenced · 180 without coordinates

Open the institutions mapphysical evidence1 328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	354
Ekaterinburg, RU	106
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	54
RMZlocation not on record	49
NTNU-VMlocation not on record	20
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	11
Edmonton, CA	10
SLU Artdatabankenlocation not on record	10
Copenhagen, DK	7
Tartu, EE	7
Uniwersytet w Białymstokulocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Metsähallituslocation not on record	4
Brussels, BE	3
Adam Mickiewicz University in Poznańlocation not on record	3
Cambridge, US	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1
NHMOlocation not on record	1
Rovaniemi, FI	1
University of Oulu, Zoological Museumlocation not on record	1
Institute of Plant and Animal Ecology (IPAE)location not on record	1
Akademia Pomorska w Słupskulocation not on record	1
WIlocation not on record	1
MZLUlocation not on record	1

26 institutions · 666 of 1 328 vouchered records shown · 662 without an institution code

09Environmental DNA38 detections

Where the DNA of Allomengea scopigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys3

Countries6

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map6 countries0

1. Forest & Woodland | 1.1 Boreal ForestWetlandboreal forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 6.50–14.6

Seasonal swing summer↔winter37.4 °C

Max temp (day)14.6 °C 9.70–18.6

Min temp (night)7.10 °C 3.20–10.7

Precipitation89.7 mm/mo 62.2–133

Air humidity61.6 % 55.6–68.0

Moisture balance6.50 mm/mo -45.6–62.4

Vapour deficit485 Pa 310–728

Wind speed2.40 m/s 2.20–6.70

Cloud cover47.0 % 44.1–56.2

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allomengea scopigera

At a glance

Sources7 archives

Morphometry1

Predation1

Ecology6

At a glance

Record type1 865 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 865 records