Allograpta neotropica

Curran, 1936 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Allograpta

At a glance

Occurrence records482

Data sources6

Biological traits0

DNA specimens12

eDNA detections3

Sources6 archives

Databases and archives Allograpta neotropica's data was compiled from.

GBIFGlobal Biodiversity Information Facility482 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF482 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allograpta neotropica has left across the world's sequence archives.

At a glance

DNA specimens12

BINs5

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

7Amostly conserved

10Cmostly conserved

19Cmostly conserved

43Amostly conserved

55Tmostly conserved

56Gvariable

82Cvariable

88Amostly conserved

106Cvariable

163Tmostly conserved

187Tmostly conserved

205Tvariable

208Gvariable

220Tmostly conserved

235Cvariable

263Cvariable

301Tmostly conserved

307Tmostly conserved

316Amostly conserved

337Amostly conserved

340Cvariable

346Tmostly conserved

349Tvariable

370Amostly conserved

376Avariable

394Tvariable

406Cvariable

421Amostly conserved

428Tmostly conserved

433Tvariable

451Amostly conserved

496Amostly conserved

508Amostly conserved

547Amostly conserved

577Amostly conserved

589Tmostly conserved

595Tmostly conserved

596Cvariable

616Cmostly conserved

619Amostly conserved

631Amostly conserved

634Tvariable

646Tvariable

TACATTATACTTTCTATTCGGAGCTTGAGCTGGAATAGTAGGAACATCTTTAAGTGTTTTAATTCGTGCAGAACTTGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes8

BINs5

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allograpta obliquasame genus4.6%Allograpta piuranasame genus4.9%Allograpta neosplendenssame genus4.9%Allograpta exoticasame genus5.3%Allograpta robinsonianasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Allograpta neotropica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J., B. C. Boyes, J. M. van Brink and J. Vockeroth (1973). "Cytotaxonomy of South American Syrphinae (Diptera: Syrphidae)." Genetica 44(3): 368-415. ↗

08Occurrence & distribution

Record type482 records

Wild obs. + sensor9

Museum / vouchered473

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3>10 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 472 without coordinates

Open the institutions mapphysical evidence473

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFPRlocation not on record	261
National Biodiversity Institute, Costa Ricalocation not on record	209
Washington, US	2
Universidad de Antioquia (UdeA)location not on record	1

4 institutions · 473 of 473 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Allograpta neotropica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 9.20–24.2

Seasonal swing summer↔winter1.90 °C

Max temp (day)25.2 °C 13.4–26.7

Min temp (night)19.1 °C 6.30–22.3

Precipitation442 mm/mo 186–474

Air humidity72.4 % 58.6–77.1

Moisture balance313 mm/mo 76.6–352

Vapour deficit561 Pa 450–806

Wind speed3.10 m/s 1.90–3.20

Cloud cover42.5 % 21.0–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)