Allograpta exotica

(Wiedemann, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Allograpta

At a glance

Occurrence records2 759

Data sources9

Biological traits0

DNA specimens19

eDNA detections19

Sources9 archives

Databases and archives Allograpta exotica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 759 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 759 records

Environmental DNA1 datasets · 3 countries19 detections

DNA & barcodingBOLD19 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Allograpta exotica is a species in the family Syrphidae ("syrphid flies"), in the order Diptera ("flies").

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allograpta exotica has left across the world's sequence archives.

At a glance

DNA specimens19

BINs3

Marker genes2

eDNA detections19

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

1Tmostly conserved

4Amostly conserved

14Cvariable

25Tmostly conserved

49Avariable

50Tmostly conserved

52Amostly conserved

59Tvariable

67Tmostly conserved

74Cmostly conserved

76Tmostly conserved

82Cmostly conserved

88Amostly conserved

100Tmostly conserved

106Tmostly conserved

118Tmostly conserved

145Tvariable

169Amostly conserved

184Amostly conserved

190Tmostly conserved

193Cvariable

202Tmostly conserved

256Tmostly conserved

271Tmostly conserved

274Tmostly conserved

277Amostly conserved

283Tvariable

284Cmostly conserved

287Cmostly conserved

289Tmostly conserved

298Tmostly conserved

301Tmostly conserved

307Amostly conserved

325Tmostly conserved

334Amostly conserved

337Tmostly conserved

343Tmostly conserved

347Cmostly conserved

349Tmostly conserved

352Tmostly conserved

358Tmostly conserved

364Amostly conserved

379Amostly conserved

382Tmostly conserved

386Tmostly conserved

401Cvariable

412Amostly conserved

415Avariable

421Tvariable

433Avariable

451Amostly conserved

454Avariable

475Cvariable

478Amostly conserved

482Tmostly conserved

514Amostly conserved

526Amostly conserved

536Cmostly conserved

538Tmostly conserved

553Amostly conserved

556Tmostly conserved

562Amostly conserved

565Tmostly conserved

586Amostly conserved

589Tmostly conserved

591Gmostly conserved

592Tmostly conserved

604Amostly conserved

616Tmostly conserved

619Amostly conserved

622Amostly conserved

628Amostly conserved

634Cmostly conserved

646Cmostly conserved

652Tvariable

TACATTATATTTTCTATTTGGAGCTTGAGCTGGTATAGTAGGAACATCATTAAGTATTTTAATTCGTGCAGAACTTGGTCACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.9%

Haplotypes4

BINs3

Most divergent pair9.6%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allograpta piuranasame genus3.0%Allograpta neosplendenssame genus3.2%Allograpta obliquasame genus3.5%Allograpta falcatasame genus4.6%Allograpta neotropicasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Allograpta exotica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J., B. C. Boyes, J. M. van Brink and J. Vockeroth (1973). "Cytotaxonomy of South American Syrphinae (Diptera: Syrphidae)." Genetica 44(3): 368-415. ↗

08Occurrence & distribution

Record type2 759 records

Wild obs. + sensor1 849

Museum / vouchered910

Origin

Native173

Range

Area of Occupancy AOO5 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 948≤1 km 298≤10 km 62>10 km 166

1 474 georeferenced · 375 without coordinates

Open the mapobservation + sensor1 849

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 229≤1 km 30≤10 km 55>10 km 32

346 georeferenced · 564 without coordinates

Open the institutions mapphysical evidence910

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFPRlocation not on record	221
Los Angeles, US	173
Essig Museum of Entomologylocation not on record	148
Mexico City, MX	126
National Biodiversity Institute, Costa Ricalocation not on record	101
Lubbock, US	55
US	18
PUC-RSlocation not on record	13
Santa Cruz, US	11
INTAlocation not on record	8
San Diego, US	7
University of Guelphlocation not on record	4
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	3
Museo Entomologico de Leonlocation not on record	3
Lake Placid, US	2
Ciudad de México, MX	2
Georgia Museum of Natural Historylocation not on record	2
US	2
Universidad de Antioquia (UdeA)location not on record	1
Washington, US	1
San Francisco, US	1
California Department for Food and Agriculturelocation not on record	1
CUlocation not on record	1

23 institutions · 904 of 910 vouchered records shown · 5 without an institution code

09Environmental DNA19 detections

Where the DNA of Allograpta exotica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

Tropical dry forest1. Forest & Woodland|1.6. Subtropical/Tropic…1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 22.1–28.4

Seasonal swing summer↔winter2.40 °C

Max temp (day)29.6 °C 27.0–34.0

Min temp (night)20.4 °C 17.2–23.9

Precipitation44.9 mm/mo 23.2–328

Air humidity61.0 % 49.3–69.4

Moisture balance-116 mm/mo -158–231

Vapour deficit1,182 Pa 899–1,641

Wind speed4.50 m/s 1.80–7.20

Cloud cover17.9 % 13.6–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allograpta exotica

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 759 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 759 records