Allogalathea elegans

(Adams & White, 1848) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Galatheidae/Allogalathea

At a glance

Occurrence records1 154

Data sources9

Biological traits4

DNA specimens30

eDNA detections28

Sources9 archives

Databases and archives Allogalathea elegans's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility757 records↗

OBISOcean Biodiversity Information System397 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 154 records

Environmental DNA1 datasets · 6 countries28 detections

DNA & barcodingBOLD30 specimens

01Narrative

Allogalathea elegans (known as the feather star squat lobster, crinoid squat lobster or elegant squat lobster) is a species of squat lobster that is sometimes kept in marine aquariums. Despite their common name, they are more closely related to hermit crabs than lobsters.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits2

Depth max146 m

Depth min0 m

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allogalathea elegans has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes3

eDNA detections28

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

28Amostly conserved

55Amostly conserved

61Tmostly conserved

67Tmostly conserved

103Tmostly conserved

127Cmostly conserved

190Tmostly conserved

193Cmostly conserved

211Amostly conserved

226Tmostly conserved

235Cmostly conserved

271Gmostly conserved

287Tmostly conserved

304Gmostly conserved

310Amostly conserved

328Avariable

337Cmostly conserved

343Tmostly conserved

346Cmostly conserved

367Tmostly conserved

385Tmostly conserved

386Amostly conserved

418Amostly conserved

430Amostly conserved

466Gmostly conserved

472Tmostly conserved

512Tmostly conserved

529Tmostly conserved

547Amostly conserved

589Tmostly conserved

598Tmostly conserved

622Cmostly conserved

631Amostly conserved

AACACTTTATTTTATTTTTGGTGCATGAGCAGGAATAGTTGGAACTTCACTAAGACTTATTATCCGTGCTGAACTAGGACAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes19

BIN1

Most divergent pair2.9%

OceaniaAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allogalathea inermissame genus12.4%Allogalathea babaisame genus12.5%Galathea strigosasame family14.8%Galathea homologasame family15.0%Aegla riolimayanasame order15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_066048 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ND2ATP8ATP6COX3ND5ND4ND4LND6CYTBND1ND3rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type1 154 records

Wild obs. + sensor359

Museum / vouchered795

Range

Area of Occupancy AOO1 904 km²

Depth

0–200 m sunlit175

200–1000 m twilight4

1–4 km midnight1

>4 km abyssal0

median 23.6 m · max 1 113 m · 180 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 91≤1 km 157≤10 km 44>10 km 14

306 georeferenced · 53 without coordinates

Open the mapobservation + sensor359

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 122≤1 km 101≤10 km 21>10 km 19

263 georeferenced · 532 without coordinates

Open the institutions mapphysical evidence795

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	113
Paris, FR	76
CASlocation not on record	71
Western Australian Museumlocation not on record	48
Sydney, AU	43
Washington, US	20
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	18
Museums Victorialocation not on record	17
Copenhagen, DK	15
Museum and Art Gallery of the Northern Territorylocation not on record	11
Earth Sciences New Zealandlocation not on record	10
Australian National Fish Collectionlocation not on record	5
DEWlocation not on record	4
Los Angeles, US	4
Frankfurt am Main	3
CRUSTlocation not on record	1
Brussels, BE	1
National Marine Biodiversity Institute of Korealocation not on record	1
National Institute of Water and Atmospheric Research, Wellingtonlocation not on record	1

19 institutions · 462 of 795 vouchered records shown · 5 without an institution code

09Environmental DNA28 detections

Where the DNA of Allogalathea elegans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 23.0–25.5

Seasonal swing summer↔winter5.70 °C

Max temp (day)26.5 °C 24.1–27.4

Min temp (night)22.9 °C 20.2–23.9

Precipitation159 mm/mo 69.8–208

Air humidity61.9 % 58.7–64.9

Vapour deficit1,132 Pa 1,073–1,258

Cloud cover37.5 % 20.7–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allogalathea elegans

At a glance

Sources9 archives

Habitat & environment2

Other traits2

At a glance

Record type1 154 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 154 records