Allogalathea babai

Cabezas, Macpherson & Machordom, 2011 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Galatheidae/Allogalathea

At a glance

Occurrence records193

Data sources6

Biological traits4

DNA specimens26

eDNA detections26

Sources6 archives

Databases and archives Allogalathea babai's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

OBISOcean Biodiversity Information System33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS193 records

Environmental DNA1 datasets · 4 countries26 detections

DNA & barcodingBOLD26 specimens

01Narrative

Allogalathea babai est une espèce de petits crustacés décapodes de la famille des galathées. Elle est plus communément appelée Galathée Baba des Crinoïdes du fait qu'elle est inféodée aux comatules, hôtes dans lesquels elle trouve abri et nourriture. L'espèce a été décrite en 2011 par Patricia Cabezas, Enrique Macpherson et Annie Machordom. Avant ça, le genre Allogalathea était considéré comme monospécifique et ne comportait que l'espèce Allogalathea elegans. Depuis cette révision en 2011, le genre comporte 4 espèces distinctes et valides dont Allogalathea babai.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max80 m

Depth min10 m

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allogalathea babai has left across the world's sequence archives.

At a glance

DNA specimens26

BINs2

Marker genes3

eDNA detections26

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

25Amostly conserved

79Cmostly conserved

94Gmostly conserved

103Tmostly conserved

139Cmostly conserved

166Amostly conserved

197Tmostly conserved

202Cmostly conserved

217Tmostly conserved

223Cmostly conserved

235Tvariable

241Gmostly conserved

253Gmostly conserved

265Tmostly conserved

274Cmostly conserved

278Cmostly conserved

301Gmostly conserved

343Cmostly conserved

373Avariable

385Tmostly conserved

388Amostly conserved

415Amostly conserved

417Tmostly conserved

433Amostly conserved

445Tmostly conserved

446Amostly conserved

472Cmostly conserved

490Cmostly conserved

493Amostly conserved

502Tmostly conserved

517Amostly conserved

542Cmostly conserved

544Tmostly conserved

565Cmostly conserved

574Tmostly conserved

578Tmostly conserved

581Tmostly conserved

595Tmostly conserved

616Tmostly conserved

622Cmostly conserved

634Tmostly conserved

AACACTTTATTTTATTTTTGGTGCATGAGCAGGAATAGTAGGAACTTCACTAAGACTTATTATCCGTGCTGAATTAGGCCAACCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.00%

Haplotypes7

BINs2

Most divergent pair1.1%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allogalathea inermissame genus11.5%Allogalathea eleganssame genus12.5%Allogalathea longimanasame genus13.4%Haematobosca stimulanssame order17.0%Archytas diaphanussame order17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type193 records

Wild obs. + sensor120

Museum / vouchered73

Range

Area of Occupancy AOO504 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 7.6 m · max 9.9 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 27≤1 km 39≤10 km 19>10 km 17

102 georeferenced · 18 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	29
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
CASlocation not on record	5

3 institutions · 40 of 73 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Allogalathea babai was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 22.0–23.0

Seasonal swing summer↔winter6.10 °C

Max temp (day)25.7 °C 25.7–27.2

Min temp (night)20.2 °C 15.5–20.2

Precipitation155 mm/mo 155–202

Air humidity61.9 % 61.9–64.6

Moisture balance24.9 mm/mo 24.9–239

Vapour deficit1,073 Pa 1,073–1,126

Wind speed1.60 m/s 1.60–3.90

Cloud cover37.5 % 37.5–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)