Allocosa senex

(Mello-Leitão, 1945) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Allocosa

At a glance

Occurrence records116

Data sources6

Biological traits41

DNA specimens71

eDNA detections68

Sources6 archives

Databases and archives Allocosa senex's data was compiled from.

GBIFGlobal Biodiversity Information Facility116 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI68 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

World Spider Trait DBMasaryk University41 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources41 traits

Occurrence & distributionGBIF116 records

Environmental DNA1 datasets · 1 countries68 detections

DNA & barcodingBOLD71 specimens

02Traits & measurements

SourcesWolff et al. 2022Craig et al. 2020Simó et al. 2017

Morphometry34

ALE0.2 mm

AME0.3 mm

Abdomen length♀7.15·♂7.2 mm

Abdomen width4.6 mm

Body length♀13·♂16.6 mm

Cephalothorax length♀6.2·♂9.4 mm

Cephalothorax width♀4.8·♂7.2 mm

Chelicerae basal part (paturon) length3.5 mm

Femur I length♀5.3·♂7.8 mm

Femur II length♀5.1·♂7.4 mm

Femur III length♀4.6·♂6.9 mm

Femur IV length♀6·♂8.1 mm

Leg I length♀18.4·♂27.1 mm

Leg II length♀18·♂26 mm

Leg III length♀17.5·♂26.2 mm

Leg IV length♀23.2·♂32 mm

Metatarsus I length♀4·♂6.1 mm

Metatarsus II length♀3.9·♂6 mm

Metatarsus III length♀4.4·♂6.5 mm

Metatarsus IV length♀5.6·♂7.9 mm

PLE0.4 mm

PME0.45 mm

Patella I length♀2.6·♂3.3 mm

Patella II length♀2.5·♂3.2 mm

Patella III length♀2.3·♂3.4 mm

Patella IV length♀3.1·♂4 mm

Tarsus I length♀2·♂3.2 mm

Tarsus II length♀2.3·♂3.2 mm

Tarsus III length♀2.4·♂3.6 mm

Tarsus IV length♀3·♂4.1 mm

Tibia I length♀4.5·♂6.7 mm

Tibia II length♀4.2·♂6.2 mm

Tibia III length♀3.8·♂5.8 mm

Tibia IV length♀5.5·♂7.6 mm

Predation2

Hunting guild 2ground runner

Web buildingno

Biomechanics4

'Primary mode of locomotionwalking

Silk strain0.27 mm

Silk strength84.29 mm

Silk toughness12.81 mm

Morphology1

Cribellumabsent

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allocosa senex has left across the world's sequence archives.

At a glance

DNA specimens71

BINs4

Marker genes1

eDNA detections68

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P676 bp consensus71 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

40Amostly conserved

43Tmostly conserved

46Amostly conserved

160Gmostly conserved

199Gmostly conserved

202Gmostly conserved

211Amostly conserved

256Cmostly conserved

286Amostly conserved

295Amostly conserved

304Amostly conserved

580Gmostly conserved

625Gmostly conserved

GACTTTGTATTTAATATTTGGTGTATGGTCTGCTATAGTAGGTACAGCTATAAGAGTATTAATTCGAATAGAATTAGGACATTCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes13

BINs4

Most divergent pair1.9%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allocosa marindiasame genus2.4%Allocosa alticepssame genus5.6%Gnatholycosa spinipalpissame family6.2%Allocosa parvasame genus7.0%Paratrochosina amicasame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type116 records

Wild obs. + sensor75

Museum / vouchered41

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 29≤1 km 28≤10 km 5>10 km 3

65 georeferenced · 10 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 2>10 km 1

4 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	10
MCTPlocation not on record	3
Museo de La Platalocation not on record	1
PUC-RSlocation not on record	1

4 institutions · 15 of 41 vouchered records shown · 26 without an institution code

09Environmental DNA68 detections

Where the DNA of Allocosa senex was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found68

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 68 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 13.5–13.5

Seasonal swing summer↔winter13.9 °C

Max temp (day)18.8 °C

Min temp (night)9.00 °C

Precipitation54.6 mm/mo

Air humidity59.2 %

Moisture balance-19.9 mm/mo

Vapour deficit630 Pa

Wind speed3.20 m/s

Cloud cover31.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)