Allocosa marindia

Simó, Lise, Pompozzi & Laborda, 2017 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Allocosa

At a glance

Occurrence records15

Data sources6

Biological traits28

DNA specimens12

eDNA detections10

Sources6 archives

Databases and archives Allocosa marindia's data was compiled from.

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

World Spider Trait DBMasaryk University28 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources28 traits

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD12 specimens

02Traits & measurements

SourcesSimó et al. 2017

Morphometry28

Abdomen length♀5.3·♂4.6 mm

Body length♀9.4·♂8.9 mm

Cephalothorax length♀4.1·♂4.3 mm

Cephalothorax width♀2.9·♂4.7 mm

Femur I length♀2.9·♂3.1 mm

Femur II length♀2.6·♂2.7 mm

Femur III length♀2.5·♂3 mm

Femur IV length♀3.2·♂3.5 mm

Leg I length♀9.8·♂10.9 mm

Leg II length♀9·♂9.7 mm

Leg III length♀8.8·♂9.9 mm

Leg IV length♀12·♂12.9 mm

Metatarsus I length♀1.9·♂2.2 mm

Metatarsus II length♀1.9·♂2.1 mm

Metatarsus III length♀2·♂2.2 mm

Metatarsus IV length♀2.9·♂3 mm

Patella I length♀1.4·♂1.5 mm

Patella II length♀1.3·♂1.4 mm

Patella III length♀1.2·♂1.3 mm

Patella IV length♀1.6·♂1.6 mm

Tarsus I length♀1.3·♂1.4 mm

Tarsus II length♀1.2·♂1.2 mm

Tarsus III length♀1.2·♂1.4 mm

Tarsus IV length♀1.6·♂1.6 mm

Tibia I length♀2.3·♂2.7 mm

Tibia II length♀2·♂2.3 mm

Tibia III length♀1.9·♂2 mm

Tibia IV length♀2.7·♂3.2 mm

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allocosa marindia has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P676 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.69%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 17 variable positions, in barcode order

103Cmostly conserved

154Cmostly conserved

212Cmostly conserved

229Amostly conserved

286Amostly conserved

304Gmostly conserved

373Amostly conserved

487Amostly conserved

520Amostly conserved

526Tmostly conserved

538Gmostly conserved

542Cmostly conserved

550Amostly conserved

565Gmostly conserved

661Gvariable

664Tmostly conserved

670Tmostly conserved

GACTTTATATTTAATATTTGGTGTATGGTCTGCTATAGTAGGAACGGCTATAAGAGTATTAATTCGAATAGAATTAGGACATTCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allocosa senexsame genus2.4%Allocosa brasiliensissame genus2.4%Gnatholycosa spinipalpissame family5.9%Allocosa alticepssame genus6.2%Paratrochosina amicasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type15 records

Museum / vouchered15

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	2
MCTPlocation not on record	1

2 institutions · 3 of 15 vouchered records shown · 12 without an institution code

09Environmental DNA10 detections

Where the DNA of Allocosa marindia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)