Allocosa funerea

(Hentz, 1844) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Lycosidae/Allocosa

At a glance

Occurrence records659

Data sources8

Biological traits3

DNA specimens29

eDNA detections27

Sources8 archives

Databases and archives Allocosa funerea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility659 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

World Spider Trait DBMasaryk University3 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF659 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD29 specimens

01Narrative

Allocosa funerea is a species of wolf spider in the family Lycosidae. It is found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesDondale & Redner 1990

Morphometry3

Body length♀4.8·♂4 mm

Cephalothorax length♀2.4·♂2.26 mm

Cephalothorax width♀1.76·♂1.61 mm

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allocosa funerea has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections27

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

34Amostly conserved

310Gmostly conserved

379Gmostly conserved

538Gmostly conserved

580Avariable

625Avariable

TTTATATTTAATGTTTGGTGTATGGTCTGCTATAGTTGGTACGGCTATAAGAGTATTAATTCGAATGGAATTAGGACATTCTGGAAGTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes5

BIN1

Most divergent pair0.77%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allocosa parvasame genus6.0%Allocosa absolutasame genus6.4%Allocosa subparvasame genus6.7%Allocosa brasiliensissame genus7.4%Allocosa senexsame genus7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type659 records

Wild obs. + sensor501

Museum / vouchered158

Range

Area of Occupancy AOO2 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 251≤1 km 62≤10 km 20>10 km 102

435 georeferenced · 66 without coordinates

Open the mapobservation + sensor501

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 20>10 km 6

26 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence158

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	85
Cambridge, US	37
Chicago, US	22
Denver, US	7
College Station, US	2
University of Indianapolislocation not on record	2
Buenos Aires, AR	1
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 157 of 158 vouchered records shown · 1 without an institution code

09Environmental DNA27 detections

Where the DNA of Allocosa funerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

14. Artificial - Terrestrial | 14.2 Pasturel…near lake

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 21.4–24.4

Seasonal swing summer↔winter25.6 °C

Max temp (day)25.8 °C 25.8–28.6

Min temp (night)17.2 °C 16.9–20.2

Precipitation103 mm/mo 103–114

Air humidity60.2 % 59.8–60.3

Moisture balance-65.2 mm/mo -68.6–-35.6

Vapour deficit1,025 Pa 1,024–1,230

Wind speed4.30 m/s 2.70–4.30

Cloud cover41.8 % 37.7–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)